Repository: dguo/strsim-rs Branch: main Commit: dacc84c0dc61 Files: 14 Total size: 54.4 KB Directory structure: gitextract_h7ck84ay/ ├── .editorconfig ├── .gitattributes ├── .github/ │ ├── FUNDING.yml │ └── workflows/ │ └── ci.yml ├── .gitignore ├── CHANGELOG.md ├── Cargo.toml ├── LICENSE ├── README.md ├── SECURITY.md ├── benches/ │ └── benches.rs ├── dev ├── src/ │ └── lib.rs └── tests/ └── lib.rs ================================================ FILE CONTENTS ================================================ ================================================ FILE: .editorconfig ================================================ # editorconfig.org root = true [*] charset = utf-8 end_of_line = lf indent_brace_style = K&R indent_size = 4 indent_style = space insert_final_newline = true max_line_length = 80 trim_trailing_whitespace = true ================================================ FILE: .gitattributes ================================================ # Override core.autocrlf settings to keep line endings consistent (LF) * text=auto ================================================ FILE: .github/FUNDING.yml ================================================ github: [dguo, maxbachmann] ko_fi: dannyguo liberapay: dannyguo custom: ["https://www.paypal.com/donate/?hosted_button_id=VGWQBBD5CTWJU", "https://www.paypal.com/paypalme/DannyGuo", "https://www.buymeacoffee.com/dannyguo"] ================================================ FILE: .github/workflows/ci.yml ================================================ name: CI on: push: branches: - main pull_request: jobs: build: strategy: matrix: os: ["macos-latest", "ubuntu-latest", "windows-latest"] rust: ["1.56", "beta", "stable"] runs-on: ${{ matrix.os }} steps: - uses: actions/checkout@v4 - name: Install Rust uses: dtolnay/rust-toolchain@master with: toolchain: ${{ matrix.rust }} - name: Build the code run: cargo build --verbose - name: Test the code run: cargo test --verbose check-formatting: runs-on: ubuntu-latest steps: - uses: actions/checkout@v4 - name: Install Rust uses: dtolnay/rust-toolchain@stable - name: Check formatting run: cargo fmt --check ================================================ FILE: .gitignore ================================================ /target /Cargo.lock *.swp *.swo .DS_Store ================================================ FILE: CHANGELOG.md ================================================ # Change Log This project attempts to adhere to [Semantic Versioning](http://semver.org). ## [Unreleased] ## [0.11.1] - (2024-04-03) ### Fixed - Drop MSRV down to 1.56 which was mistakenly changed in 0.11.0 ## [0.11.0] - (2024-01-07) ### Changed - improve OSA implementation - reduce runtime - reduce binary size by more than `25%` - reduce binary size of Levenshtein distance - improve Damerau-Levenshtein implementation - reduce memory usage from `O(N*M)` to `O(N+M)` - reduce runtime in our own benchmark by more than `70%` - reduce binary size by more than `25%` - only boost similarity in Jaro-Winkler once the Jaro similarity exceeds 0.7 ### Fixed - Fix transposition counting in Jaro and Jaro-Winkler. - Limit common prefix in Jaro-Winkler to 4 characters ## [0.10.0] - (2020-01-31) ### Added - Sørensen-Dice implementation (thanks [@robjtede](https://github.com/robjtede)) ## [0.9.3] - (2019-12-12) ### Fixed - Fix Jaro and Jaro-Winkler when the arguments have lengths of 1 and are equal. Previously, the functions would erroneously return 0 instead of 1. Thanks to [@vvrably](https://github.com/vvrably) for pointing out the issue. ## [0.9.2] - (2019-05-09) ### Changed - Revert back to the standard library hashmap because it will use hashbrown very soon - Remove ndarray in favor of using a single vector to represent the 2d grid in Damerau-Levenshtein ## [0.9.1] - (2019-04-08) ### Changed - Faster Damerau-Levenshtein implementation (thanks [@lovasoa](https://github.com/lovasoa)) ## [0.9.0] - (2019-04-06) ### Added - Generic distance functions (thanks [@lovasoa](https://github.com/lovasoa)) ## [0.8.0] - (2018-08-19) ### Added - Normalized versions of Levenshtein and Damerau-Levenshtein (thanks [@gentoid](https://github.com/gentoid)) ## [0.7.0] - (2018-01-17) ### Changed - Faster Levenshtein implementation (thanks [@wdv4758h](https://github.com/wdv4758h)) ### Removed - Remove the "against_vec" functions. They are one-liners now, so they don't seem to add enough value to justify making the API larger. I didn't find anybody using them when I skimmed through a GitHub search. If you do use them, you can change the calls to something like: ```rust let distances = strings.iter().map(|a| jaro(target, a)).collect(); ``` ## [0.6.0] - (2016-12-26) ### Added - Add optimal string alignment distance ### Fixed - Fix Damerau-Levenshtein implementation (previous implementation was actually optimal string alignment; see this [Damerau-Levenshtein explanation]) ## [0.5.2] - (2016-11-21) ### Changed - Remove Cargo generated documentation in favor of a [docs.rs] link ## [0.5.1] - (2016-08-23) ### Added - Add Cargo generated documentation ### Fixed - Fix panic when Jaro or Jaro-Winkler are given strings both with a length of one ## [0.5.0] - (2016-08-11) ### Changed - Make Hamming faster (thanks @IBUzPE9) when the two strings have the same length but slower when they have different lengths ## [0.4.1] - (2016-04-18) ### Added - Add Vagrant setup for development - Add AppVeyor configuration for Windows CI ### Fixed - Fix metrics when given strings with multibyte characters (thanks @WanzenBug) ## [0.4.0] - (2015-06-10) ### Added - For each metric, add a function that takes a vector of strings and returns a vector of results (thanks @ovarene) ## [0.3.0] - (2015-04-30) ### Changed - Remove usage of unstable Rust features ## [0.2.5] - (2015-04-24) ### Fixed - Remove unnecessary `Float` import from doc tests ## [0.2.4] - (2015-04-15) ### Fixed - Remove unused `core` feature flag ## [0.2.3] - (2015-04-01) ### Fixed - Remove now unnecessary `Float` import ## [0.2.2] - (2015-03-29) ### Fixed - Remove usage of `char_at` (marked as unstable) ## [0.2.1] - (2015-02-20) ### Fixed - Update bit vector import to match Rust update ## [0.2.0] - (2015-02-19) ### Added - Implement Damerau-Levenshtein - Add tests in docs ## [0.1.1] - (2015-02-10) ### Added - Configure Travis for CI - Add rustdoc comments ### Fixed - Limit Jaro-Winkler return value to a maximum of 1.0 - Fix float comparisons in tests ## [0.1.0] - (2015-02-09) ### Added - Implement Hamming, Jaro, Jaro-Winkler, and Levenshtein [Unreleased]: https://github.com/rapidfuzz/strsim-rs/compare/0.11.1...HEAD [0.11.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.11.0...0.11.1 [0.11.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.10.0...0.11.0 [0.10.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.9.3...0.10.0 [0.9.3]: https://github.com/rapidfuzz/strsim-rs/compare/0.9.2...0.9.3 [0.9.2]: https://github.com/rapidfuzz/strsim-rs/compare/0.9.1...0.9.2 [0.9.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.9.0...0.9.1 [0.9.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.8.0...0.9.0 [0.8.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.7.0...0.8.0 [0.7.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.6.0...0.7.0 [0.6.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.5.2...0.6.0 [0.5.2]: https://github.com/rapidfuzz/strsim-rs/compare/0.5.1...0.5.2 [0.5.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.5.0...0.5.1 [0.5.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.4.1...0.5.0 [0.4.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.4.0...0.4.1 [0.4.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.3.0...0.4.0 [0.3.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.5...0.3.0 [0.2.5]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.4...0.2.5 [0.2.4]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.3...0.2.4 [0.2.3]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.2...0.2.3 [0.2.2]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.1...0.2.2 [0.2.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.0...0.2.1 [0.2.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.1.1...0.2.0 [0.1.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.1.0...0.1.1 [0.1.0]: https://github.com/rapidfuzz/strsim-rs/compare/fabad4...0.1.0 [docs.rs]: https://docs.rs/strsim/ [Damerau-Levenshtein explanation]: http://scarcitycomputing.blogspot.com/2013/04/damerau-levenshtein-edit-distance.html ================================================ FILE: Cargo.toml ================================================ [package] name = "strsim" version = "0.11.1" authors = ["Danny Guo ", "maxbachmann "] description = """ Implementations of string similarity metrics. Includes Hamming, Levenshtein, OSA, Damerau-Levenshtein, Jaro, Jaro-Winkler, and Sørensen-Dice. """ edition = "2021" license = "MIT" rust-version = "1.56" readme = "README.md" keywords = ["string", "similarity", "Hamming", "Levenshtein", "Jaro"] homepage = "https://github.com/rapidfuzz/strsim-rs" repository = "https://github.com/rapidfuzz/strsim-rs" documentation = "https://docs.rs/strsim/" exclude = ["/.github", "/dev"] categories = ["text-processing"] ================================================ FILE: LICENSE ================================================ The MIT License (MIT) Copyright (c) 2015 Danny Guo Copyright (c) 2016 Titus Wormer Copyright (c) 2018 Akash Kurdekar Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ================================================ FILE: README.md ================================================ # strsim-rs [![Crates.io](https://img.shields.io/crates/v/strsim.svg)](https://crates.io/crates/strsim) [![Crates.io](https://img.shields.io/crates/l/strsim.svg?maxAge=2592000)](https://github.com/rapidfuzz/strsim-rs/blob/main/LICENSE) [![CI status](https://github.com/rapidfuzz/strsim-rs/workflows/CI/badge.svg)](https://github.com/rapidfuzz/strsim-rs/actions?query=branch%3Amain) [![unsafe forbidden](https://img.shields.io/badge/unsafe-forbidden-success.svg)](https://github.com/rust-secure-code/safety-dance/) [Rust](https://www.rust-lang.org) implementations of [string similarity metrics]: - [Hamming] - [Levenshtein] - distance & normalized - [Optimal string alignment] - [Damerau-Levenshtein] - distance & normalized - [Jaro and Jaro-Winkler] - [Sørensen-Dice] The normalized versions return values between `0.0` and `1.0`, where `1.0` means an exact match. There are also generic versions of the functions for non-string inputs. ## Installation `strsim` is available on [crates.io](https://crates.io/crates/strsim). Add it to your project: ```sh cargo add strsim ``` ## Usage Go to [Docs.rs](https://docs.rs/strsim/) for the full documentation. You can also clone the repo, and run `$ cargo doc --open`. ### Examples ```rust extern crate strsim; use strsim::{hamming, levenshtein, normalized_levenshtein, osa_distance, damerau_levenshtein, normalized_damerau_levenshtein, jaro, jaro_winkler, sorensen_dice}; fn main() { match hamming("hamming", "hammers") { Ok(distance) => assert_eq!(3, distance), Err(why) => panic!("{:?}", why) } assert_eq!(levenshtein("kitten", "sitting"), 3); assert!((normalized_levenshtein("kitten", "sitting") - 0.571).abs() < 0.001); assert_eq!(osa_distance("ac", "cba"), 3); assert_eq!(damerau_levenshtein("ac", "cba"), 2); assert!((normalized_damerau_levenshtein("levenshtein", "löwenbräu") - 0.272).abs() < 0.001); assert!((jaro("Friedrich Nietzsche", "Jean-Paul Sartre") - 0.392).abs() < 0.001); assert!((jaro_winkler("cheeseburger", "cheese fries") - 0.911).abs() < 0.001); assert_eq!(sorensen_dice("web applications", "applications of the web"), 0.7878787878787878); } ``` Using the generic versions of the functions: ```rust extern crate strsim; use strsim::generic_levenshtein; fn main() { assert_eq!(2, generic_levenshtein(&[1, 2, 3], &[0, 2, 5])); } ``` ## Contributing If you don't want to install Rust itself, you can run `$ ./dev` for a development CLI if you have [Docker] installed. Benchmarks require a Nightly toolchain. Run `$ cargo +nightly bench`. ## License [MIT](https://github.com/rapidfuzz/strsim-rs/blob/main/LICENSE) [string similarity metrics]:http://en.wikipedia.org/wiki/String_metric [Damerau-Levenshtein]:http://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance [Jaro and Jaro-Winkler]:http://en.wikipedia.org/wiki/Jaro%E2%80%93Winkler_distance [Levenshtein]:http://en.wikipedia.org/wiki/Levenshtein_distance [Hamming]:http://en.wikipedia.org/wiki/Hamming_distance [Optimal string alignment]:https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance#Optimal_string_alignment_distance [Sørensen-Dice]:http://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient [Docker]:https://docs.docker.com/engine/installation/ ================================================ FILE: SECURITY.md ================================================ ## Reporting Security Issues If you believe you have found a security vulnerability in the project, please report it to us through coordinated disclosure. **Please do not report security vulnerabilities through public GitHub issues, discussions, or pull requests.** Instead, please send an email to oss@maxbachmann.de. Please include as much of the information listed below as you can to help us better understand and resolve the issue: * The type of issue (e.g., buffer overflow, SQL injection, or cross-site scripting) * Full paths of source file(s) related to the manifestation of the issue * The location of the affected source code (tag/branch/commit or direct URL) * Any special configuration required to reproduce the issue * Step-by-step instructions to reproduce the issue * Proof-of-concept or exploit code (if possible) * Impact of the issue, including how an attacker might exploit the issue This information will help us triage your report more quickly. ================================================ FILE: benches/benches.rs ================================================ //! Benchmarks for strsim. #![feature(test)] extern crate strsim; extern crate test; use self::test::Bencher; #[bench] fn bench_hamming(bencher: &mut Bencher) { let a = "ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGG"; let b = "CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGC"; bencher.iter(|| { strsim::hamming(a, b).unwrap(); }) } #[bench] fn bench_jaro(bencher: &mut Bencher) { let a = "Philosopher Friedrich Nietzsche"; let b = "Philosopher Jean-Paul Sartre"; bencher.iter(|| { strsim::jaro(a, b); }) } #[bench] fn bench_jaro_winkler(bencher: &mut Bencher) { let a = "Philosopher Friedrich Nietzsche"; let b = "Philosopher Jean-Paul Sartre"; bencher.iter(|| { strsim::jaro_winkler(a, b); }) } #[bench] fn bench_levenshtein(bencher: &mut Bencher) { let a = "Philosopher Friedrich Nietzsche"; let b = "Philosopher Jean-Paul Sartre"; bencher.iter(|| { strsim::levenshtein(a, b); }) } #[bench] fn bench_levenshtein_on_u8(bencher: &mut Bencher) { bencher.iter(|| { strsim::generic_levenshtein(&vec![0u8; 30], &vec![7u8; 31]); }) } #[bench] fn bench_normalized_levenshtein(bencher: &mut Bencher) { let a = "Philosopher Friedrich Nietzsche"; let b = "Philosopher Jean-Paul Sartre"; bencher.iter(|| { strsim::normalized_levenshtein(a, b); }) } #[bench] fn bench_osa_distance(bencher: &mut Bencher) { let a = "Philosopher Friedrich Nietzsche"; let b = "Philosopher Jean-Paul Sartre"; bencher.iter(|| { strsim::osa_distance(a, b); }) } #[bench] fn bench_damerau_levenshtein(bencher: &mut Bencher) { let a = "Philosopher Friedrich Nietzsche"; let b = "Philosopher Jean-Paul Sartre"; bencher.iter(|| { strsim::damerau_levenshtein(a, b); }) } #[bench] fn bench_normalized_damerau_levenshtein(bencher: &mut Bencher) { let a = "Philosopher Friedrich Nietzsche"; let b = "Philosopher Jean-Paul Sartre"; bencher.iter(|| { strsim::normalized_damerau_levenshtein(a, b); }) } #[bench] fn bench_sorensen_dice(bencher: &mut Bencher) { let a = "Philosopher Friedrich Nietzsche"; let b = "Philosopher Jean-Paul Sartre"; bencher.iter(|| { strsim::sorensen_dice(a, b); }) } ================================================ FILE: dev ================================================ #!/usr/bin/env python3 # ./dev --help import argparse import os from subprocess import run import sys parser = argparse.ArgumentParser(prog='./dev') subparsers = parser.add_subparsers(metavar='', title='commands') command = [ 'docker', 'run', '-it', '--rm', '-v', os.getcwd() + ':/src:cached', '-w=/src', 'rust:1.31.0' ] def cargo(args, remaining): sys.exit(run(command + ['cargo'] + remaining or []).returncode) parser_cargo = subparsers.add_parser('cargo', help='run a cargo command') parser_cargo.set_defaults(func=cargo) def sh(args, remaining): sys.exit(run(command + ['bash']).returncode) parser_sh = subparsers.add_parser('sh', help='bring up a shell') parser_sh.set_defaults(func=sh) def test(args, remaining): sys.exit(run(command + ['cargo', 'test']).returncode) parser_test = subparsers.add_parser('test', help='run tests') parser_test.set_defaults(func=test) if len(sys.argv) > 1: args, remaining = parser.parse_known_args() try: args.func(args, remaining) except FileNotFoundError: sys.exit('Please install Docker.') else: parser.print_help() ================================================ FILE: src/lib.rs ================================================ //! This library implements string similarity metrics. #![forbid(unsafe_code)] #![warn(rust_2018_idioms)] #![allow( // these casts are sometimes needed. They restrict the length of input iterators // but there isn't really any way around this except for always working with // 128 bit types clippy::cast_possible_wrap, clippy::cast_sign_loss, clippy::cast_precision_loss, // not practical clippy::similar_names, // noisy clippy::missing_errors_doc, clippy::missing_panics_doc, clippy::must_use_candidate, // todo https://github.com/rapidfuzz/strsim-rs/issues/59 clippy::range_plus_one )] use std::char; use std::cmp::{max, min}; use std::collections::HashMap; use std::convert::TryFrom; use std::error::Error; use std::fmt::{self, Display, Formatter}; use std::hash::Hash; use std::mem; use std::str::Chars; #[derive(Debug, PartialEq)] pub enum StrSimError { DifferentLengthArgs, } impl Display for StrSimError { fn fmt(&self, fmt: &mut Formatter<'_>) -> Result<(), fmt::Error> { let text = match self { StrSimError::DifferentLengthArgs => "Differing length arguments provided", }; write!(fmt, "{}", text) } } impl Error for StrSimError {} pub type HammingResult = Result; /// Calculates the number of positions in the two sequences where the elements /// differ. Returns an error if the sequences have different lengths. pub fn generic_hamming(a: Iter1, b: Iter2) -> HammingResult where Iter1: IntoIterator, Iter2: IntoIterator, Elem1: PartialEq, { let (mut ita, mut itb) = (a.into_iter(), b.into_iter()); let mut count = 0; loop { match (ita.next(), itb.next()) { (Some(x), Some(y)) => { if x != y { count += 1; } } (None, None) => return Ok(count), _ => return Err(StrSimError::DifferentLengthArgs), } } } /// Calculates the number of positions in the two strings where the characters /// differ. Returns an error if the strings have different lengths. /// /// ``` /// use strsim::{hamming, StrSimError::DifferentLengthArgs}; /// /// assert_eq!(Ok(3), hamming("hamming", "hammers")); /// /// assert_eq!(Err(DifferentLengthArgs), hamming("hamming", "ham")); /// ``` pub fn hamming(a: &str, b: &str) -> HammingResult { generic_hamming(a.chars(), b.chars()) } /// Calculates the Jaro similarity between two sequences. The returned value /// is between 0.0 and 1.0 (higher value means more similar). pub fn generic_jaro<'a, 'b, Iter1, Iter2, Elem1, Elem2>(a: &'a Iter1, b: &'b Iter2) -> f64 where &'a Iter1: IntoIterator, &'b Iter2: IntoIterator, Elem1: PartialEq, { let a_len = a.into_iter().count(); let b_len = b.into_iter().count(); if a_len == 0 && b_len == 0 { return 1.0; } else if a_len == 0 || b_len == 0 { return 0.0; } let mut search_range = max(a_len, b_len) / 2; search_range = search_range.saturating_sub(1); // combine memory allocations to reduce runtime let mut flags_memory = vec![false; a_len + b_len]; let (a_flags, b_flags) = flags_memory.split_at_mut(a_len); let mut matches = 0_usize; for (i, a_elem) in a.into_iter().enumerate() { // prevent integer wrapping let min_bound = i.saturating_sub(search_range); let max_bound = min(b_len, i + search_range + 1); for (j, b_elem) in b.into_iter().enumerate().take(max_bound) { if min_bound <= j && a_elem == b_elem && !b_flags[j] { a_flags[i] = true; b_flags[j] = true; matches += 1; break; } } } let mut transpositions = 0_usize; if matches != 0 { let mut b_iter = b_flags.iter().zip(b); for (a_flag, ch1) in a_flags.iter().zip(a) { if *a_flag { loop { if let Some((b_flag, ch2)) = b_iter.next() { if !*b_flag { continue; } if ch1 != ch2 { transpositions += 1; } break; } } } } } transpositions /= 2; if matches == 0 { 0.0 } else { ((matches as f64 / a_len as f64) + (matches as f64 / b_len as f64) + ((matches - transpositions) as f64 / matches as f64)) / 3.0 } } struct StringWrapper<'a>(&'a str); impl<'b> IntoIterator for &StringWrapper<'b> { type Item = char; type IntoIter = Chars<'b>; fn into_iter(self) -> Self::IntoIter { self.0.chars() } } /// Calculates the Jaro similarity between two strings. The returned value /// is between 0.0 and 1.0 (higher value means more similar). /// /// ``` /// use strsim::jaro; /// /// assert!((0.392 - jaro("Friedrich Nietzsche", "Jean-Paul Sartre")).abs() < /// 0.001); /// ``` pub fn jaro(a: &str, b: &str) -> f64 { generic_jaro(&StringWrapper(a), &StringWrapper(b)) } /// Like Jaro but gives a boost to sequences that have a common prefix. pub fn generic_jaro_winkler<'a, 'b, Iter1, Iter2, Elem1, Elem2>(a: &'a Iter1, b: &'b Iter2) -> f64 where &'a Iter1: IntoIterator, &'b Iter2: IntoIterator, Elem1: PartialEq, { let sim = generic_jaro(a, b); if sim > 0.7 { let prefix_length = a .into_iter() .take(4) .zip(b) .take_while(|(a_elem, b_elem)| a_elem == b_elem) .count(); sim + 0.1 * prefix_length as f64 * (1.0 - sim) } else { sim } } /// Like Jaro but gives a boost to strings that have a common prefix. /// /// ``` /// use strsim::jaro_winkler; /// /// assert!((0.866 - jaro_winkler("cheeseburger", "cheese fries")).abs() < /// 0.001); /// ``` pub fn jaro_winkler(a: &str, b: &str) -> f64 { generic_jaro_winkler(&StringWrapper(a), &StringWrapper(b)) } /// Calculates the minimum number of insertions, deletions, and substitutions /// required to change one sequence into the other. /// /// ``` /// use strsim::generic_levenshtein; /// /// assert_eq!(3, generic_levenshtein(&[1,2,3], &[1,2,3,4,5,6])); /// ``` pub fn generic_levenshtein<'a, 'b, Iter1, Iter2, Elem1, Elem2>(a: &'a Iter1, b: &'b Iter2) -> usize where &'a Iter1: IntoIterator, &'b Iter2: IntoIterator, Elem1: PartialEq, { let b_len = b.into_iter().count(); let mut cache: Vec = (1..b_len + 1).collect(); let mut result = b_len; for (i, a_elem) in a.into_iter().enumerate() { result = i + 1; let mut distance_b = i; for (j, b_elem) in b.into_iter().enumerate() { let cost = usize::from(a_elem != b_elem); let distance_a = distance_b + cost; distance_b = cache[j]; result = min(result + 1, min(distance_a, distance_b + 1)); cache[j] = result; } } result } /// Calculates the minimum number of insertions, deletions, and substitutions /// required to change one string into the other. /// /// ``` /// use strsim::levenshtein; /// /// assert_eq!(3, levenshtein("kitten", "sitting")); /// ``` pub fn levenshtein(a: &str, b: &str) -> usize { generic_levenshtein(&StringWrapper(a), &StringWrapper(b)) } /// Calculates a normalized score of the Levenshtein algorithm between 0.0 and /// 1.0 (inclusive), where 1.0 means the strings are the same. /// /// ``` /// use strsim::normalized_levenshtein; /// /// assert!((normalized_levenshtein("kitten", "sitting") - 0.57142).abs() < 0.00001); /// assert!((normalized_levenshtein("", "") - 1.0).abs() < 0.00001); /// assert!(normalized_levenshtein("", "second").abs() < 0.00001); /// assert!(normalized_levenshtein("first", "").abs() < 0.00001); /// assert!((normalized_levenshtein("string", "string") - 1.0).abs() < 0.00001); /// ``` pub fn normalized_levenshtein(a: &str, b: &str) -> f64 { if a.is_empty() && b.is_empty() { return 1.0; } 1.0 - (levenshtein(a, b) as f64) / (a.chars().count().max(b.chars().count()) as f64) } /// Like Levenshtein but allows for adjacent transpositions. Each substring can /// only be edited once. /// /// ``` /// use strsim::osa_distance; /// /// assert_eq!(3, osa_distance("ab", "bca")); /// ``` pub fn osa_distance(a: &str, b: &str) -> usize { let b_len = b.chars().count(); // 0..=b_len behaves like 0..b_len.saturating_add(1) which could be a different size // this leads to significantly worse code gen when swapping the vectors below let mut prev_two_distances: Vec = (0..b_len + 1).collect(); let mut prev_distances: Vec = (0..b_len + 1).collect(); let mut curr_distances: Vec = vec![0; b_len + 1]; let mut prev_a_char = char::MAX; let mut prev_b_char = char::MAX; for (i, a_char) in a.chars().enumerate() { curr_distances[0] = i + 1; for (j, b_char) in b.chars().enumerate() { let cost = usize::from(a_char != b_char); curr_distances[j + 1] = min( curr_distances[j] + 1, min(prev_distances[j + 1] + 1, prev_distances[j] + cost), ); if i > 0 && j > 0 && a_char != b_char && a_char == prev_b_char && b_char == prev_a_char { curr_distances[j + 1] = min(curr_distances[j + 1], prev_two_distances[j - 1] + 1); } prev_b_char = b_char; } mem::swap(&mut prev_two_distances, &mut prev_distances); mem::swap(&mut prev_distances, &mut curr_distances); prev_a_char = a_char; } // access prev_distances instead of curr_distances since we swapped // them above. In case a is empty this would still contain the correct value // from initializing the last element to b_len prev_distances[b_len] } /* Returns the final index for a value in a single vector that represents a fixed 2d grid */ fn flat_index(i: usize, j: usize, width: usize) -> usize { j * width + i } /// Like optimal string alignment, but substrings can be edited an unlimited /// number of times, and the triangle inequality holds. /// /// ``` /// use strsim::generic_damerau_levenshtein; /// /// assert_eq!(2, generic_damerau_levenshtein(&[1,2], &[2,3,1])); /// ``` pub fn generic_damerau_levenshtein(a_elems: &[Elem], b_elems: &[Elem]) -> usize where Elem: Eq + Hash + Clone, { let a_len = a_elems.len(); let b_len = b_elems.len(); if a_len == 0 { return b_len; } if b_len == 0 { return a_len; } let width = a_len + 2; let mut distances = vec![0; (a_len + 2) * (b_len + 2)]; let max_distance = a_len + b_len; distances[0] = max_distance; for i in 0..(a_len + 1) { distances[flat_index(i + 1, 0, width)] = max_distance; distances[flat_index(i + 1, 1, width)] = i; } for j in 0..(b_len + 1) { distances[flat_index(0, j + 1, width)] = max_distance; distances[flat_index(1, j + 1, width)] = j; } let mut elems: HashMap = HashMap::with_capacity(64); for i in 1..(a_len + 1) { let mut db = 0; for j in 1..(b_len + 1) { let k = match elems.get(&b_elems[j - 1]) { Some(&value) => value, None => 0, }; let insertion_cost = distances[flat_index(i, j + 1, width)] + 1; let deletion_cost = distances[flat_index(i + 1, j, width)] + 1; let transposition_cost = distances[flat_index(k, db, width)] + (i - k - 1) + 1 + (j - db - 1); let mut substitution_cost = distances[flat_index(i, j, width)] + 1; if a_elems[i - 1] == b_elems[j - 1] { db = j; substitution_cost -= 1; } distances[flat_index(i + 1, j + 1, width)] = min( substitution_cost, min(insertion_cost, min(deletion_cost, transposition_cost)), ); } elems.insert(a_elems[i - 1].clone(), i); } distances[flat_index(a_len + 1, b_len + 1, width)] } #[derive(Clone, Copy, PartialEq, Eq)] struct RowId { val: isize, } impl Default for RowId { fn default() -> Self { Self { val: -1 } } } #[derive(Default, Clone)] struct GrowingHashmapMapElemChar { key: u32, value: ValueType, } /// specialized hashmap to store user provided types /// this implementation relies on a couple of base assumptions in order to simplify the implementation /// - the hashmap does not have an upper limit of included items /// - the default value for the `ValueType` can be used as a dummy value to indicate an empty cell /// - elements can't be removed /// - only allocates memory on first write access. /// This improves performance for hashmaps that are never written to struct GrowingHashmapChar { used: i32, fill: i32, mask: i32, map: Option>>, } impl Default for GrowingHashmapChar where ValueType: Default + Clone + Eq, { fn default() -> Self { Self { used: 0, fill: 0, mask: -1, map: None, } } } impl GrowingHashmapChar where ValueType: Default + Clone + Eq + Copy, { fn get(&self, key: u32) -> ValueType { self.map .as_ref() .map_or_else(|| Default::default(), |map| map[self.lookup(key)].value) } fn get_mut(&mut self, key: u32) -> &mut ValueType { if self.map.is_none() { self.allocate(); } let mut i = self.lookup(key); if self .map .as_ref() .expect("map should have been created above")[i] .value == Default::default() { self.fill += 1; // resize when 2/3 full if self.fill * 3 >= (self.mask + 1) * 2 { self.grow((self.used + 1) * 2); i = self.lookup(key); } self.used += 1; } let elem = &mut self .map .as_mut() .expect("map should have been created above")[i]; elem.key = key; &mut elem.value } fn allocate(&mut self) { self.mask = 8 - 1; self.map = Some(vec![GrowingHashmapMapElemChar::default(); 8]); } /// lookup key inside the hashmap using a similar collision resolution /// strategy to `CPython` and `Ruby` fn lookup(&self, key: u32) -> usize { let hash = key; let mut i = hash as usize & self.mask as usize; let map = self .map .as_ref() .expect("callers have to ensure map is allocated"); if map[i].value == Default::default() || map[i].key == key { return i; } let mut perturb = key; loop { i = (i * 5 + perturb as usize + 1) & self.mask as usize; if map[i].value == Default::default() || map[i].key == key { return i; } perturb >>= 5; } } fn grow(&mut self, min_used: i32) { let mut new_size = self.mask + 1; while new_size <= min_used { new_size <<= 1; } self.fill = self.used; self.mask = new_size - 1; let old_map = std::mem::replace( self.map .as_mut() .expect("callers have to ensure map is allocated"), vec![GrowingHashmapMapElemChar::::default(); new_size as usize], ); for elem in old_map { if elem.value != Default::default() { let j = self.lookup(elem.key); let new_elem = &mut self.map.as_mut().expect("map created above")[j]; new_elem.key = elem.key; new_elem.value = elem.value; self.used -= 1; if self.used == 0 { break; } } } self.used = self.fill; } } struct HybridGrowingHashmapChar { map: GrowingHashmapChar, extended_ascii: [ValueType; 256], } impl HybridGrowingHashmapChar where ValueType: Default + Clone + Copy + Eq, { fn get(&self, key: char) -> ValueType { let value = key as u32; if value <= 255 { let val_u8 = u8::try_from(value).expect("we check the bounds above"); self.extended_ascii[usize::from(val_u8)] } else { self.map.get(value) } } fn get_mut(&mut self, key: char) -> &mut ValueType { let value = key as u32; if value <= 255 { let val_u8 = u8::try_from(value).expect("we check the bounds above"); &mut self.extended_ascii[usize::from(val_u8)] } else { self.map.get_mut(value) } } } impl Default for HybridGrowingHashmapChar where ValueType: Default + Clone + Copy + Eq, { fn default() -> Self { HybridGrowingHashmapChar { map: GrowingHashmapChar::default(), extended_ascii: [Default::default(); 256], } } } fn damerau_levenshtein_impl(s1: Iter1, len1: usize, s2: Iter2, len2: usize) -> usize where Iter1: Iterator + Clone, Iter2: Iterator + Clone, { // The implementations is based on the paper // `Linear space string correction algorithm using the Damerau-Levenshtein distance` // from Chunchun Zhao and Sartaj Sahni // // It has a runtime complexity of `O(N*M)` and a memory usage of `O(N+M)`. let max_val = max(len1, len2) as isize + 1; let mut last_row_id = HybridGrowingHashmapChar::::default(); let size = len2 + 2; let mut fr = vec![max_val; size]; let mut r1 = vec![max_val; size]; let mut r: Vec = (max_val..max_val + 1) .chain(0..(size - 1) as isize) .collect(); for (i, ch1) in s1.enumerate().map(|(i, ch1)| (i + 1, ch1)) { mem::swap(&mut r, &mut r1); let mut last_col_id: isize = -1; let mut last_i2l1 = r[1]; r[1] = i as isize; let mut t = max_val; for (j, ch2) in s2.clone().enumerate().map(|(j, ch2)| (j + 1, ch2)) { let diag = r1[j] + isize::from(ch1 != ch2); let left = r[j] + 1; let up = r1[j + 1] + 1; let mut temp = min(diag, min(left, up)); if ch1 == ch2 { last_col_id = j as isize; // last occurence of s1_i fr[j + 1] = r1[j - 1]; // save H_k-1,j-2 t = last_i2l1; // save H_i-2,l-1 } else { let k = last_row_id.get(ch2).val; let l = last_col_id; if j as isize - l == 1 { let transpose = fr[j + 1] + (i as isize - k); temp = min(temp, transpose); } else if i as isize - k == 1 { let transpose = t + (j as isize - l); temp = min(temp, transpose); } } last_i2l1 = r[j + 1]; r[j + 1] = temp; } last_row_id.get_mut(ch1).val = i as isize; } r[len2 + 1] as usize } /// Like optimal string alignment, but substrings can be edited an unlimited /// number of times, and the triangle inequality holds. /// /// ``` /// use strsim::damerau_levenshtein; /// /// assert_eq!(2, damerau_levenshtein("ab", "bca")); /// ``` pub fn damerau_levenshtein(a: &str, b: &str) -> usize { damerau_levenshtein_impl(a.chars(), a.chars().count(), b.chars(), b.chars().count()) } /// Calculates a normalized score of the Damerau–Levenshtein algorithm between /// 0.0 and 1.0 (inclusive), where 1.0 means the strings are the same. /// /// ``` /// use strsim::normalized_damerau_levenshtein; /// /// assert!((normalized_damerau_levenshtein("levenshtein", "löwenbräu") - 0.27272).abs() < 0.00001); /// assert!((normalized_damerau_levenshtein("", "") - 1.0).abs() < 0.00001); /// assert!(normalized_damerau_levenshtein("", "flower").abs() < 0.00001); /// assert!(normalized_damerau_levenshtein("tree", "").abs() < 0.00001); /// assert!((normalized_damerau_levenshtein("sunglasses", "sunglasses") - 1.0).abs() < 0.00001); /// ``` pub fn normalized_damerau_levenshtein(a: &str, b: &str) -> f64 { if a.is_empty() && b.is_empty() { return 1.0; } let len1 = a.chars().count(); let len2 = b.chars().count(); let dist = damerau_levenshtein_impl(a.chars(), len1, b.chars(), len2); 1.0 - (dist as f64) / (max(len1, len2) as f64) } /// Returns an Iterator of char tuples. fn bigrams(s: &str) -> impl Iterator + '_ { s.chars().zip(s.chars().skip(1)) } /// Calculates a Sørensen-Dice similarity distance using bigrams. /// See . /// /// ``` /// use strsim::sorensen_dice; /// /// assert_eq!(1.0, sorensen_dice("", "")); /// assert_eq!(0.0, sorensen_dice("", "a")); /// assert_eq!(0.0, sorensen_dice("french", "quebec")); /// assert_eq!(1.0, sorensen_dice("ferris", "ferris")); /// assert_eq!(0.8888888888888888, sorensen_dice("feris", "ferris")); /// ``` pub fn sorensen_dice(a: &str, b: &str) -> f64 { // implementation guided by // https://github.com/aceakash/string-similarity/blob/f83ba3cd7bae874c20c429774e911ae8cff8bced/src/index.js#L6 let a: String = a.chars().filter(|&x| !char::is_whitespace(x)).collect(); let b: String = b.chars().filter(|&x| !char::is_whitespace(x)).collect(); if a == b { return 1.0; } if a.len() < 2 || b.len() < 2 { return 0.0; } let mut a_bigrams: HashMap<(char, char), usize> = HashMap::new(); for bigram in bigrams(&a) { *a_bigrams.entry(bigram).or_insert(0) += 1; } let mut intersection_size = 0_usize; for bigram in bigrams(&b) { a_bigrams.entry(bigram).and_modify(|bi| { if *bi > 0 { *bi -= 1; intersection_size += 1; } }); } (2 * intersection_size) as f64 / (a.len() + b.len() - 2) as f64 } #[cfg(test)] mod tests { use super::*; macro_rules! assert_delta { ($x:expr, $y:expr) => { assert_delta!($x, $y, 1e-5); }; ($x:expr, $y:expr, $d:expr) => { if ($x - $y).abs() > $d { panic!( "assertion failed: actual: `{}`, expected: `{}`: \ actual not within < {} of expected", $x, $y, $d ); } }; } #[test] fn bigrams_iterator() { let mut bi = bigrams("abcde"); assert_eq!(Some(('a', 'b')), bi.next()); assert_eq!(Some(('b', 'c')), bi.next()); assert_eq!(Some(('c', 'd')), bi.next()); assert_eq!(Some(('d', 'e')), bi.next()); assert_eq!(None, bi.next()); } fn assert_hamming_dist(dist: usize, str1: &str, str2: &str) { assert_eq!(Ok(dist), hamming(str1, str2)); } #[test] fn hamming_empty() { assert_hamming_dist(0, "", "") } #[test] fn hamming_same() { assert_hamming_dist(0, "hamming", "hamming") } #[test] fn hamming_numbers() { assert_eq!(Ok(1), generic_hamming(&[1, 2, 4], &[1, 2, 3])); } #[test] fn hamming_diff() { assert_hamming_dist(3, "hamming", "hammers") } #[test] fn hamming_diff_multibyte() { assert_hamming_dist(2, "hamming", "h香mmüng"); } #[test] fn hamming_unequal_length() { assert_eq!( Err(StrSimError::DifferentLengthArgs), generic_hamming("ham".chars(), "hamming".chars()) ); } #[test] fn hamming_names() { assert_hamming_dist(14, "Friedrich Nietzs", "Jean-Paul Sartre") } #[test] fn jaro_both_empty() { assert_eq!(1.0, jaro("", "")); } #[test] fn jaro_first_empty() { assert_eq!(0.0, jaro("", "jaro")); } #[test] fn jaro_second_empty() { assert_eq!(0.0, jaro("distance", "")); } #[test] fn jaro_same() { assert_eq!(1.0, jaro("jaro", "jaro")); } #[test] fn jaro_multibyte() { assert_delta!(0.818, jaro("testabctest", "testöঙ香test"), 0.001); assert_delta!(0.818, jaro("testöঙ香test", "testabctest"), 0.001); } #[test] fn jaro_diff_short() { assert_delta!(0.767, jaro("dixon", "dicksonx"), 0.001); } #[test] fn jaro_diff_one_character() { assert_eq!(0.0, jaro("a", "b")); } #[test] fn jaro_same_one_character() { assert_eq!(1.0, jaro("a", "a")); } #[test] fn generic_jaro_diff() { assert_eq!(0.0, generic_jaro(&[1, 2], &[3, 4])); } #[test] fn jaro_diff_one_and_two() { assert_delta!(0.83, jaro("a", "ab"), 0.01); } #[test] fn jaro_diff_two_and_one() { assert_delta!(0.83, jaro("ab", "a"), 0.01); } #[test] fn jaro_diff_no_transposition() { assert_delta!(0.822, jaro("dwayne", "duane"), 0.001); } #[test] fn jaro_diff_with_transposition() { assert_delta!(0.944, jaro("martha", "marhta"), 0.001); assert_delta!(0.6, jaro("a jke", "jane a k"), 0.001); } #[test] fn jaro_names() { assert_delta!( 0.392, jaro("Friedrich Nietzsche", "Jean-Paul Sartre"), 0.001 ); } #[test] fn jaro_winkler_both_empty() { assert_eq!(1.0, jaro_winkler("", "")); } #[test] fn jaro_winkler_first_empty() { assert_eq!(0.0, jaro_winkler("", "jaro-winkler")); } #[test] fn jaro_winkler_second_empty() { assert_eq!(0.0, jaro_winkler("distance", "")); } #[test] fn jaro_winkler_same() { assert_eq!(1.0, jaro_winkler("Jaro-Winkler", "Jaro-Winkler")); } #[test] fn jaro_winkler_multibyte() { assert_delta!(0.89, jaro_winkler("testabctest", "testöঙ香test"), 0.001); assert_delta!(0.89, jaro_winkler("testöঙ香test", "testabctest"), 0.001); } #[test] fn jaro_winkler_diff_short() { assert_delta!(0.813, jaro_winkler("dixon", "dicksonx"), 0.001); assert_delta!(0.813, jaro_winkler("dicksonx", "dixon"), 0.001); } #[test] fn jaro_winkler_diff_one_character() { assert_eq!(0.0, jaro_winkler("a", "b")); } #[test] fn jaro_winkler_same_one_character() { assert_eq!(1.0, jaro_winkler("a", "a")); } #[test] fn jaro_winkler_diff_no_transposition() { assert_delta!(0.84, jaro_winkler("dwayne", "duane"), 0.001); } #[test] fn jaro_winkler_diff_with_transposition() { assert_delta!(0.961, jaro_winkler("martha", "marhta"), 0.001); assert_delta!(0.6, jaro_winkler("a jke", "jane a k"), 0.001); } #[test] fn jaro_winkler_names() { assert_delta!( 0.452, jaro_winkler("Friedrich Nietzsche", "Fran-Paul Sartre"), 0.001 ); } #[test] fn jaro_winkler_long_prefix() { assert_delta!(0.866, jaro_winkler("cheeseburger", "cheese fries"), 0.001); } #[test] fn jaro_winkler_more_names() { assert_delta!(0.868, jaro_winkler("Thorkel", "Thorgier"), 0.001); } #[test] fn jaro_winkler_length_of_one() { assert_delta!(0.738, jaro_winkler("Dinsdale", "D"), 0.001); } #[test] fn jaro_winkler_very_long_prefix() { assert_delta!( 0.98519, jaro_winkler("thequickbrownfoxjumpedoverx", "thequickbrownfoxjumpedovery") ); } #[test] fn levenshtein_empty() { assert_eq!(0, levenshtein("", "")); } #[test] fn levenshtein_same() { assert_eq!(0, levenshtein("levenshtein", "levenshtein")); } #[test] fn levenshtein_diff_short() { assert_eq!(3, levenshtein("kitten", "sitting")); } #[test] fn levenshtein_diff_with_space() { assert_eq!(5, levenshtein("hello, world", "bye, world")); } #[test] fn levenshtein_diff_multibyte() { assert_eq!(3, levenshtein("öঙ香", "abc")); assert_eq!(3, levenshtein("abc", "öঙ香")); } #[test] fn levenshtein_diff_longer() { let a = "The quick brown fox jumped over the angry dog."; let b = "Lorem ipsum dolor sit amet, dicta latine an eam."; assert_eq!(37, levenshtein(a, b)); } #[test] fn levenshtein_first_empty() { assert_eq!(7, levenshtein("", "sitting")); } #[test] fn levenshtein_second_empty() { assert_eq!(6, levenshtein("kitten", "")); } #[test] fn normalized_levenshtein_diff_short() { assert_delta!(0.57142, normalized_levenshtein("kitten", "sitting")); } #[test] fn normalized_levenshtein_for_empty_strings() { assert_delta!(1.0, normalized_levenshtein("", "")); } #[test] fn normalized_levenshtein_first_empty() { assert_delta!(0.0, normalized_levenshtein("", "second")); } #[test] fn normalized_levenshtein_second_empty() { assert_delta!(0.0, normalized_levenshtein("first", "")); } #[test] fn normalized_levenshtein_identical_strings() { assert_delta!(1.0, normalized_levenshtein("identical", "identical")); } #[test] fn osa_distance_empty() { assert_eq!(0, osa_distance("", "")); } #[test] fn osa_distance_same() { assert_eq!(0, osa_distance("damerau", "damerau")); } #[test] fn osa_distance_first_empty() { assert_eq!(7, osa_distance("", "damerau")); } #[test] fn osa_distance_second_empty() { assert_eq!(7, osa_distance("damerau", "")); } #[test] fn osa_distance_diff() { assert_eq!(3, osa_distance("ca", "abc")); } #[test] fn osa_distance_diff_short() { assert_eq!(3, osa_distance("damerau", "aderua")); } #[test] fn osa_distance_diff_reversed() { assert_eq!(3, osa_distance("aderua", "damerau")); } #[test] fn osa_distance_diff_multibyte() { assert_eq!(3, osa_distance("öঙ香", "abc")); assert_eq!(3, osa_distance("abc", "öঙ香")); } #[test] fn osa_distance_diff_unequal_length() { assert_eq!(6, osa_distance("damerau", "aderuaxyz")); } #[test] fn osa_distance_diff_unequal_length_reversed() { assert_eq!(6, osa_distance("aderuaxyz", "damerau")); } #[test] fn osa_distance_diff_comedians() { assert_eq!(5, osa_distance("Stewart", "Colbert")); } #[test] fn osa_distance_many_transpositions() { assert_eq!(4, osa_distance("abcdefghijkl", "bacedfgihjlk")); } #[test] fn osa_distance_diff_longer() { let a = "The quick brown fox jumped over the angry dog."; let b = "Lehem ipsum dolor sit amet, dicta latine an eam."; assert_eq!(36, osa_distance(a, b)); } #[test] fn osa_distance_beginning_transposition() { assert_eq!(1, osa_distance("foobar", "ofobar")); } #[test] fn osa_distance_end_transposition() { assert_eq!(1, osa_distance("specter", "spectre")); } #[test] fn osa_distance_restricted_edit() { assert_eq!(4, osa_distance("a cat", "an abct")); } #[test] fn damerau_levenshtein_empty() { assert_eq!(0, damerau_levenshtein("", "")); } #[test] fn damerau_levenshtein_same() { assert_eq!(0, damerau_levenshtein("damerau", "damerau")); } #[test] fn damerau_levenshtein_first_empty() { assert_eq!(7, damerau_levenshtein("", "damerau")); } #[test] fn damerau_levenshtein_second_empty() { assert_eq!(7, damerau_levenshtein("damerau", "")); } #[test] fn damerau_levenshtein_diff() { assert_eq!(2, damerau_levenshtein("ca", "abc")); } #[test] fn damerau_levenshtein_diff_short() { assert_eq!(3, damerau_levenshtein("damerau", "aderua")); } #[test] fn damerau_levenshtein_diff_reversed() { assert_eq!(3, damerau_levenshtein("aderua", "damerau")); } #[test] fn damerau_levenshtein_diff_multibyte() { assert_eq!(3, damerau_levenshtein("öঙ香", "abc")); assert_eq!(3, damerau_levenshtein("abc", "öঙ香")); } #[test] fn damerau_levenshtein_diff_unequal_length() { assert_eq!(6, damerau_levenshtein("damerau", "aderuaxyz")); } #[test] fn damerau_levenshtein_diff_unequal_length_reversed() { assert_eq!(6, damerau_levenshtein("aderuaxyz", "damerau")); } #[test] fn damerau_levenshtein_diff_comedians() { assert_eq!(5, damerau_levenshtein("Stewart", "Colbert")); } #[test] fn damerau_levenshtein_many_transpositions() { assert_eq!(4, damerau_levenshtein("abcdefghijkl", "bacedfgihjlk")); } #[test] fn damerau_levenshtein_diff_longer() { let a = "The quick brown fox jumped over the angry dog."; let b = "Lehem ipsum dolor sit amet, dicta latine an eam."; assert_eq!(36, damerau_levenshtein(a, b)); } #[test] fn damerau_levenshtein_beginning_transposition() { assert_eq!(1, damerau_levenshtein("foobar", "ofobar")); } #[test] fn damerau_levenshtein_end_transposition() { assert_eq!(1, damerau_levenshtein("specter", "spectre")); } #[test] fn damerau_levenshtein_unrestricted_edit() { assert_eq!(3, damerau_levenshtein("a cat", "an abct")); } #[test] fn normalized_damerau_levenshtein_diff_short() { assert_delta!( 0.27272, normalized_damerau_levenshtein("levenshtein", "löwenbräu") ); } #[test] fn normalized_damerau_levenshtein_for_empty_strings() { assert_delta!(1.0, normalized_damerau_levenshtein("", "")); } #[test] fn normalized_damerau_levenshtein_first_empty() { assert_delta!(0.0, normalized_damerau_levenshtein("", "flower")); } #[test] fn normalized_damerau_levenshtein_second_empty() { assert_delta!(0.0, normalized_damerau_levenshtein("tree", "")); } #[test] fn normalized_damerau_levenshtein_identical_strings() { assert_delta!( 1.0, normalized_damerau_levenshtein("sunglasses", "sunglasses") ); } #[test] fn sorensen_dice_all() { // test cases taken from // https://github.com/aceakash/string-similarity/blob/f83ba3cd7bae874c20c429774e911ae8cff8bced/src/spec/index.spec.js#L11 assert_delta!(1.0, sorensen_dice("a", "a")); assert_delta!(0.0, sorensen_dice("a", "b")); assert_delta!(1.0, sorensen_dice("", "")); assert_delta!(0.0, sorensen_dice("a", "")); assert_delta!(0.0, sorensen_dice("", "a")); assert_delta!(1.0, sorensen_dice("apple event", "apple event")); assert_delta!(0.90909, sorensen_dice("iphone", "iphone x")); assert_delta!(0.0, sorensen_dice("french", "quebec")); assert_delta!(1.0, sorensen_dice("france", "france")); assert_delta!(0.2, sorensen_dice("fRaNce", "france")); assert_delta!(0.8, sorensen_dice("healed", "sealed")); assert_delta!( 0.78788, sorensen_dice("web applications", "applications of the web") ); assert_delta!( 0.92, sorensen_dice( "this will have a typo somewhere", "this will huve a typo somewhere" ) ); assert_delta!( 0.60606, sorensen_dice( "Olive-green table for sale, in extremely good condition.", "For sale: table in very good condition, olive green in colour." ) ); assert_delta!( 0.25581, sorensen_dice( "Olive-green table for sale, in extremely good condition.", "For sale: green Subaru Impreza, 210,000 miles" ) ); assert_delta!( 0.14118, sorensen_dice( "Olive-green table for sale, in extremely good condition.", "Wanted: mountain bike with at least 21 gears." ) ); assert_delta!( 0.77419, sorensen_dice("this has one extra word", "this has one word") ); } } ================================================ FILE: tests/lib.rs ================================================ extern crate strsim; use strsim::{ damerau_levenshtein, hamming, jaro, jaro_winkler, levenshtein, normalized_damerau_levenshtein, normalized_levenshtein, osa_distance, }; macro_rules! assert_delta { ($x:expr, $y:expr) => { assert_delta!($x, $y, 1e-5); }; ($x:expr, $y:expr, $d:expr) => { if ($x - $y).abs() > $d { panic!( "assertion failed: actual: `{}`, expected: `{}`: \ actual not within < {} of expected", $x, $y, $d ); } }; } #[test] fn hamming_works() { match hamming("hamming", "hammers") { Ok(distance) => assert_eq!(3, distance), Err(why) => panic!("{:?}", why), } } #[test] fn levenshtein_works() { assert_eq!(3, levenshtein("kitten", "sitting")); } #[test] fn normalized_levenshtein_works() { assert_delta!(0.57142, normalized_levenshtein("kitten", "sitting")); } #[test] fn osa_distance_works() { assert_eq!(3, osa_distance("ac", "cba")); } #[test] fn damerau_levenshtein_works() { assert_eq!(2, damerau_levenshtein("ac", "cba")); } #[test] fn normalized_damerau_levenshtein_works() { assert_delta!( 0.27272, normalized_damerau_levenshtein("levenshtein", "löwenbräu") ); } #[test] fn jaro_works() { assert_delta!( 0.392, jaro("Friedrich Nietzsche", "Jean-Paul Sartre"), 0.001 ); } #[test] fn jaro_winkler_works() { assert_delta!(0.866, jaro_winkler("cheeseburger", "cheese fries"), 0.001); }