Showing preview only (268K chars total). Download the full file or copy to clipboard to get everything.
Repository: LinearDesignSoftware/LinearDesign
Branch: main
Commit: f0126ca89a8b
Files: 22
Total size: 257.8 KB
Directory structure:
gitextract_f87ovany/
├── .gitattributes
├── Makefile
├── README.md
├── coding_wheel.txt
├── codon_usage_freq_table_human.csv
├── codon_usage_freq_table_yeast.csv
├── gflags.py
├── license.txt
├── lineardesign
├── src/
│ ├── Utils/
│ │ ├── base.h
│ │ ├── codon.h
│ │ ├── common.h
│ │ ├── constants.h
│ │ ├── flat.h
│ │ ├── network.h
│ │ ├── reader.h
│ │ └── utility_v.h
│ ├── backtrace_iter.cc
│ ├── beam_cky_parser.cc
│ ├── beam_cky_parser.h
│ └── linear_design.cpp
└── testseq
================================================
FILE CONTENTS
================================================
================================================
FILE: .gitattributes
================================================
*.cpp linguist-language=c++
*.h linguist-language=c++
================================================
FILE: Makefile
================================================
CLA=clang++
CXX=g++
CXXFLAGS=-std=c++11 -Ofast -DFINAL_CHECK -DSPECIAL_HP -fpermissive
DEPS=src/beam_cky_parser.cc src/beam_cky_parser.h src/backtrace_iter.cc src/Utils/reader.h src/Utils/network.h src/Utils/codon.h src/Utils/utility_v.h src/Utils/common.h src/Utils/base.h
BIN=bin/LinearDesign_2D
UNAME_S := $(shell uname -s)
UNAME_M := $(shell uname -m)
lineardesign_2D: $(DEPS)
@echo "Compiling" $@ "from" $< "..."
chmod +x lineardesign
mkdir -p ./bin
export LD_LIBRARY_PATH=.:$LD_LIBRARY_PATH
ifeq ($(UNAME_S), Linux)
if $(CXX) $(CXXFLAGS) src/linear_design.cpp -o bin/LinearDesign_2D src/Utils/libraries/LinearDesign_linux64.so; then \
echo "Linux system; compiled with g++; finished."; \
echo "Compilation Succeed!"; \
else \
echo "Try another .so file."; \
if $(CXX) $(CXXFLAGS) src/linear_design.cpp -o bin/LinearDesign_2D src/Utils/libraries/LinearDesign_linux64_old.so; then \
echo "Linux system; compiled with g++; finished."; \
echo "Compilation Succeed!"; \
else \
echo "Compilation failed! Make sure it is either Linux-64 or Mac."; \
fi \
fi
else
if [[ $(UNAME_M) == 'arm64' ]]; then \
if $(CLA) $(CXXFLAGS) src/linear_design.cpp -o bin/LinearDesign_2D src/Utils/libraries/LinearDesign_Mac_M1.so; then \
echo "Mac M1 system; compiled with clang++; finished."; \
echo "Compilation Succeed!"; \
echo "You may encounter a pop-up message at the first run. If so, please go to System Preferences -> Security & Privacy -> General to allow LinearDesign_Mac_M1.so to open. See README.md for details."; \
else \
echo "Compilation failed! Make sure it is either Linux-64 or Mac."; \
fi \
else \
if $(CLA) $(CXXFLAGS) src/linear_design.cpp -o bin/LinearDesign_2D src/Utils/libraries/LinearDesign_Mac_x86.so; then \
echo "Mac x86_64 system; compiled with clang++; finished."; \
echo "Compilation Succeed!"; \
echo "You may encounter a pop-up message at the first run. If so, please go to System Preferences -> Security & Privacy -> General to allow LinearDesign_Mac_x86.so to open. See README.md for details."; \
else \
echo "Compilation failed! Make sure it is either Linux-64 or Mac."; \
fi \
fi
endif
.PHONY : clean
clean:
rm -f $(BIN)
================================================
FILE: README.md
================================================
<img src="/pic/baidu_research_logo.jpg" width="40%" alt="Baidu Research Logo">
# Algorithm for Optimized mRNA Design Improves Stability and Immunogenicity (LinearDesign)

This repository contains the source code for the LinearDesign project.
He Zhang†, Liang Zhang†, Ang Lin†, Congcong Xu†, Ziyu Li, Kaibo Liu, Boxiang Liu, Xiaopin Ma, Fanfan Zhao, Huiling Jiang, Chunxiu Chen, Haifa Shen, Hangwen Li*, David H. Mathews*, Yujian Zhang*, Liang Huang†*<sup>#</sup>. Algorithm for Optimized mRNA Design Improves Stability and Immunogenicity. Nature [https://doi.org/10.1038/s41586-023-06127-z](https://doi.org/10.1038/s41586-023-06127-z) (2023)
† contributed equally,
\* corresponding authors,
<sup>#</sup> lead corresponding author
For questions, please contact the lead corresponding author at <liang.huang.sh@gmail.com>.
## Dependencies
Clang 11.0.0 (or above) or GCC 4.8.5 (or above)
python2.7
## To Compile
```
make
```
## To Run
The LinearDesign program can be run with:
```
echo SEQUENCE | ./lineardesign [OPTIONS]
OR
cat FASTA_FILE | ./lineardesign [OPTIONS]
```
OPTIONS:
```
--lambda LAMBDA or -l LAMBDA
```
Set LAMBDA, a hyperparameter balancing MFE and CAI. (default 0.0)
```
--codonusage FILE_NAME or -c FILE_NAME
```
Import a Codon Usage Frequency Table. See "codon_usage_freq_table_human.csv" for the format.
(default: using human codon usage frequency table)
```
--verbose or -v
```
Print out more details. (default False)
For Macbook, users may encounter a pop-up message at the first run.
For Mac-M1 system, the message is:
```
"LinearDesign_Mac_M1.so" can't be opened because Apple cannot check it for malicious software.
```
For Mac-Intel system, the message is:
```
"LinearDesign_Mac_Intel.so" cannot be opened because it is from an unidentified developer.
```
If so, please go to "System Preferences -> Security & Privacy -> General" to allow LinearDesign-Mac-M1.so (or LinearDesign-Mac-Intel.so) to open.
## Example: Single Sequence Design
```
echo MNDTEAI | ./lineardesign
mRNA sequence: AUGAACGAUACGGAGGCGAUC
mRNA structure: ......(((.((....)))))
mRNA folding free energy: -1.10 kcal/mol; mRNA CAI: 0.695
```
## Example: Multiple Sequences Design with Option --lambda (-l)
```
cat testseq | ./lineardesign --lambda 3
>seq1
mRNA sequence: AUGCCAAACACCCUGGCAUGCCCC
mRNA structure: ((((((.......)))))).....
mRNA folding free energy: -6.00 kcal/mol; mRNA CAI: 0.910
>seq2
mRNA sequence: AUGCUGGAUCAGGUGAACAAGCUGAAGUACCCAGAGGUGAGCCUGACCUGA
mRNA structure: .....((.((((((..((...(((.......)))..))..))))))))...
mRNA folding free energy: -13.50 kcal/mol; mRNA CAI: 0.979
```
## Example: Option --codonusage (-c)
```
echo MNDTEAI | ./lineardesign -l 0.3 --codonusage codon_usage_freq_table_yeast.csv
mRNA sequence: AUGAAUGAUACGGAAGCGAUC
mRNA structure: ......(((.((....)))))
mRNA folding free energy: -1.10 kcal/mol; mRNA CAI: 0.670
```
## Example: Option --verbose (-v)
```
echo MNDTEAI | ./lineardesign --verbose
Input protein: MNDTEAI
Using lambda = 0; Using codon frequency table = codon_usage_freq_table_human.csv
mRNA sequence: AUGAACGAUACGGAGGCGAUC
mRNA structure: ......(((.((....)))))
mRNA folding free energy: -1.10 kcal/mol; mRNA CAI: 0.695
Runtime: 0.002 seconds
```
## Declarations
Baidu Research has filed a patent for the LinearDesign algorithm that lists He Zhang, Liang Zhang, Ziyu Li, Kaibo Liu, Boxiang Liu, and Liang Huang as inventors.
================================================
FILE: coding_wheel.txt
================================================
Phe U U CU
Leu C U GCUA U U GA
Ser U C GCUA A G CU
Tyr U A CU
STOP U A GA U G A
Cys U G CU
Trp U G G
Pro C C GCUA
His C A CU
Gln C A GA
Arg C G GCUA A G GA
Ile A U CUA
Met A U G
Thr A C GCUA
Asn A A CU
Lys A A GA
Val G U GCUA
Asp G A CU
Glu G A GA
Gly G G GCUA
Ala G C GCUA
================================================
FILE: codon_usage_freq_table_human.csv
================================================
#,,
UAA,*,0.28
UAG,*,0.2
UGA,*,0.52
GCU,A,0.26
GCC,A,0.4
GCA,A,0.23
GCG,A,0.11
UGU,C,0.45
UGC,C,0.55
GAU,D,0.46
GAC,D,0.54
GAA,E,0.42
GAG,E,0.58
UUU,F,0.45
UUC,F,0.55
GGU,G,0.16
GGC,G,0.34
GGA,G,0.25
GGG,G,0.25
CAU,H,0.41
CAC,H,0.59
AUU,I,0.36
AUC,I,0.48
AUA,I,0.16
AAA,K,0.42
AAG,K,0.58
UUA,L,0.07
UUG,L,0.13
CUU,L,0.13
CUC,L,0.2
CUA,L,0.07
CUG,L,0.41
AUG,M,1
AAU,N,0.46
AAC,N,0.54
CCU,P,0.28
CCC,P,0.33
CCA,P,0.27
CCG,P,0.11
CAA,Q,0.25
CAG,Q,0.75
CGU,R,0.08
CGC,R,0.19
CGA,R,0.11
CGG,R,0.21
AGA,R,0.2
AGG,R,0.2
UCU,S,0.18
UCC,S,0.22
UCA,S,0.15
UCG,S,0.06
AGU,S,0.15
AGC,S,0.24
ACU,T,0.24
ACC,T,0.36
ACA,T,0.28
ACG,T,0.12
GUU,V,0.18
GUC,V,0.24
GUA,V,0.11
GUG,V,0.47
UGG,W,1
UAU,Y,0.43
UAC,Y,0.57
================================================
FILE: codon_usage_freq_table_yeast.csv
================================================
#,,
UAA,*,0.48
UAG,*,0.24
UGA,*,0.29
GCU,A,0.38
GCC,A,0.22
GCA,A,0.29
GCG,A,0.11
UGU,C,0.63
UGC,C,0.37
GAU,D,0.65
GAC,D,0.35
GAA,E,0.71
GAG,E,0.29
UUU,F,0.59
UUC,F,0.41
GGU,G,0.47
GGC,G,0.19
GGA,G,0.22
GGG,G,0.12
CAU,H,0.64
CAC,H,0.36
AUU,I,0.46
AUC,I,0.26
AUA,I,0.27
AAA,K,0.58
AAG,K,0.42
UUA,L,0.28
UUG,L,0.29
CUU,L,0.13
CUC,L,0.06
CUA,L,0.14
CUG,L,0.11
AUG,M,1
AAU,N,0.59
AAC,N,0.41
CCU,P,0.31
CCC,P,0.15
CCA,P,0.41
CCG,P,0.12
CAA,Q,0.69
CAG,Q,0.31
CGU,R,0.15
CGC,R,0.06
CGA,R,0.07
CGG,R,0.04
AGA,R,0.48
AGG,R,0.21
UCU,S,0.26
UCC,S,0.16
UCA,S,0.21
UCG,S,0.1
AGU,S,0.16
AGC,S,0.11
ACU,T,0.35
ACC,T,0.22
ACA,T,0.3
ACG,T,0.13
GUU,V,0.39
GUC,V,0.21
GUA,V,0.21
GUG,V,0.19
UGG,W,1
UAU,Y,0.56
UAC,Y,0.44
================================================
FILE: gflags.py
================================================
#!/usr/bin/env python
# Copyright (c) 2007, Google Inc.
# All rights reserved.
#
# Redistribution and use in source and binary forms, with or without
# modification, are permitted provided that the following conditions are
# met:
#
# * Redistributions of source code must retain the above copyright
# notice, this list of conditions and the following disclaimer.
# * Redistributions in binary form must reproduce the above
# copyright notice, this list of conditions and the following disclaimer
# in the documentation and/or other materials provided with the
# distribution.
# * Neither the name of Google Inc. nor the names of its
# contributors may be used to endorse or promote products derived from
# this software without specific prior written permission.
#
# THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
# "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
# A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
# OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
# SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
# LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,
# DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY
# THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
# (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
# OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
#
# ---
# Author: Chad Lester
# Design and style contributions by:
# Amit Patel, Bogdan Cocosel, Daniel Dulitz, Eric Tiedemann,
# Eric Veach, Laurence Gonsalves, Matthew Springer
# Code reorganized a bit by Craig Silverstein
"""This module is used to define and parse command line flags.
This module defines a *distributed* flag-definition policy: rather than
an application having to define all flags in or near main(), each python
module defines flags that are useful to it. When one python module
imports another, it gains access to the other's flags. (This is
implemented by having all modules share a common, global registry object
containing all the flag information.)
Flags are defined through the use of one of the DEFINE_xxx functions.
The specific function used determines how the flag is parsed, checked,
and optionally type-converted, when it's seen on the command line.
IMPLEMENTATION: DEFINE_* creates a 'Flag' object and registers it with a
'FlagValues' object (typically the global FlagValues FLAGS, defined
here). The 'FlagValues' object can scan the command line arguments and
pass flag arguments to the corresponding 'Flag' objects for
value-checking and type conversion. The converted flag values are
available as attributes of the 'FlagValues' object.
Code can access the flag through a FlagValues object, for instance
gflags.FLAGS.myflag. Typically, the __main__ module passes the
command line arguments to gflags.FLAGS for parsing.
At bottom, this module calls getopt(), so getopt functionality is
supported, including short- and long-style flags, and the use of -- to
terminate flags.
Methods defined by the flag module will throw 'FlagsError' exceptions.
The exception argument will be a human-readable string.
FLAG TYPES: This is a list of the DEFINE_*'s that you can do. All flags
take a name, default value, help-string, and optional 'short' name
(one-letter name). Some flags have other arguments, which are described
with the flag.
DEFINE_string: takes any input, and interprets it as a string.
DEFINE_bool or
DEFINE_boolean: typically does not take an argument: say --myflag to
set FLAGS.myflag to true, or --nomyflag to set
FLAGS.myflag to false. Alternately, you can say
--myflag=true or --myflag=t or --myflag=1 or
--myflag=false or --myflag=f or --myflag=0
DEFINE_float: takes an input and interprets it as a floating point
number. Takes optional args lower_bound and upper_bound;
if the number specified on the command line is out of
range, it will raise a FlagError.
DEFINE_integer: takes an input and interprets it as an integer. Takes
optional args lower_bound and upper_bound as for floats.
DEFINE_enum: takes a list of strings which represents legal values. If
the command-line value is not in this list, raise a flag
error. Otherwise, assign to FLAGS.flag as a string.
DEFINE_list: Takes a comma-separated list of strings on the commandline.
Stores them in a python list object.
DEFINE_spaceseplist: Takes a space-separated list of strings on the
commandline. Stores them in a python list object.
Example: --myspacesepflag "foo bar baz"
DEFINE_multistring: The same as DEFINE_string, except the flag can be
specified more than once on the commandline. The
result is a python list object (list of strings),
even if the flag is only on the command line once.
DEFINE_multi_int: The same as DEFINE_integer, except the flag can be
specified more than once on the commandline. The
result is a python list object (list of ints), even if
the flag is only on the command line once.
SPECIAL FLAGS: There are a few flags that have special meaning:
--help prints a list of all the flags in a human-readable fashion
--helpshort prints a list of all key flags (see below).
--helpxml prints a list of all flags, in XML format. DO NOT parse
the output of --help and --helpshort. Instead, parse
the output of --helpxml. As we add new flags, we may
add new XML elements. Hence, make sure your parser
does not crash when it encounters new XML elements.
--flagfile=foo read flags from foo.
--undefok=f1,f2 ignore unrecognized option errors for f1,f2.
For boolean flags, you should use --undefok=boolflag, and
--boolflag and --noboolflag will be accepted. Do not use
--undefok=noboolflag.
-- as in getopt(), terminates flag-processing
NOTE ON --flagfile:
Flags may be loaded from text files in addition to being specified on
the commandline.
Any flags you don't feel like typing, throw them in a file, one flag per
line, for instance:
--myflag=myvalue
--nomyboolean_flag
You then specify your file with the special flag '--flagfile=somefile'.
You CAN recursively nest flagfile= tokens OR use multiple files on the
command line. Lines beginning with a single hash '#' or a double slash
'//' are comments in your flagfile.
Any flagfile=<file> will be interpreted as having a relative path from
the current working directory rather than from the place the file was
included from:
myPythonScript.py --flagfile=config/somefile.cfg
If somefile.cfg includes further --flagfile= directives, these will be
referenced relative to the original CWD, not from the directory the
including flagfile was found in!
The caveat applies to people who are including a series of nested files
in a different dir than they are executing out of. Relative path names
are always from CWD, not from the directory of the parent include
flagfile. We do now support '~' expanded directory names.
Absolute path names ALWAYS work!
EXAMPLE USAGE:
import gflags
FLAGS = gflags.FLAGS
# Flag names are globally defined! So in general, we need to be
# careful to pick names that are unlikely to be used by other libraries.
# If there is a conflict, we'll get an error at import time.
gflags.DEFINE_string('name', 'Mr. President', 'your name')
gflags.DEFINE_integer('age', None, 'your age in years', lower_bound=0)
gflags.DEFINE_boolean('debug', False, 'produces debugging output')
gflags.DEFINE_enum('gender', 'male', ['male', 'female'], 'your gender')
def main(argv):
try:
argv = FLAGS(argv) # parse flags
except gflags.FlagsError, e:
print '%s\\nUsage: %s ARGS\\n%s' % (e, sys.argv[0], FLAGS)
sys.exit(1)
if FLAGS.debug: print 'non-flag arguments:', argv
print 'Happy Birthday', FLAGS.name
if FLAGS.age is not None:
print 'You are a %s, who is %d years old' % (FLAGS.gender, FLAGS.age)
if __name__ == '__main__':
main(sys.argv)
KEY FLAGS:
As we already explained, each module gains access to all flags defined
by all the other modules it transitively imports. In the case of
non-trivial scripts, this means a lot of flags ... For documentation
purposes, it is good to identify the flags that are key (i.e., really
important) to a module. Clearly, the concept of "key flag" is a
subjective one. When trying to determine whether a flag is key to a
module or not, assume that you are trying to explain your module to a
potential user: which flags would you really like to mention first?
We'll describe shortly how to declare which flags are key to a module.
For the moment, assume we know the set of key flags for each module.
Then, if you use the app.py module, you can use the --helpshort flag to
print only the help for the flags that are key to the main module, in a
human-readable format.
NOTE: If you need to parse the flag help, do NOT use the output of
--help / --helpshort. That output is meant for human consumption, and
may be changed in the future. Instead, use --helpxml; flags that are
key for the main module are marked there with a <key>yes</key> element.
The set of key flags for a module M is composed of:
1. Flags defined by module M by calling a DEFINE_* function.
2. Flags that module M explictly declares as key by using the function
DECLARE_key_flag(<flag_name>)
3. Key flags of other modules that M specifies by using the function
ADOPT_module_key_flags(<other_module>)
This is a "bulk" declaration of key flags: each flag that is key for
<other_module> becomes key for the current module too.
Notice that if you do not use the functions described at points 2 and 3
above, then --helpshort prints information only about the flags defined
by the main module of our script. In many cases, this behavior is good
enough. But if you move part of the main module code (together with the
related flags) into a different module, then it is nice to use
DECLARE_key_flag / ADOPT_module_key_flags and make sure --helpshort
lists all relevant flags (otherwise, your code refactoring may confuse
your users).
Note: each of DECLARE_key_flag / ADOPT_module_key_flags has its own
pluses and minuses: DECLARE_key_flag is more targeted and may lead a
more focused --helpshort documentation. ADOPT_module_key_flags is good
for cases when an entire module is considered key to the current script.
Also, it does not require updates to client scripts when a new flag is
added to the module.
EXAMPLE USAGE 2 (WITH KEY FLAGS):
Consider an application that contains the following three files (two
auxiliary modules and a main module):
File libfoo.py:
import gflags
gflags.DEFINE_integer('num_replicas', 3, 'Number of replicas to start')
gflags.DEFINE_boolean('rpc2', True, 'Turn on the usage of RPC2.')
... some code ...
File libbar.py:
import gflags
gflags.DEFINE_string('bar_gfs_path', '/gfs/path',
'Path to the GFS files for libbar.')
gflags.DEFINE_string('email_for_bar_errors', 'bar-team@google.com',
'Email address for bug reports about module libbar.')
gflags.DEFINE_boolean('bar_risky_hack', False,
'Turn on an experimental and buggy optimization.')
... some code ...
File myscript.py:
import gflags
import libfoo
import libbar
gflags.DEFINE_integer('num_iterations', 0, 'Number of iterations.')
# Declare that all flags that are key for libfoo are
# key for this module too.
gflags.ADOPT_module_key_flags(libfoo)
# Declare that the flag --bar_gfs_path (defined in libbar) is key
# for this module.
gflags.DECLARE_key_flag('bar_gfs_path')
... some code ...
When myscript is invoked with the flag --helpshort, the resulted help
message lists information about all the key flags for myscript:
--num_iterations, --num_replicas, --rpc2, and --bar_gfs_path (in
addition to the special flags --help and --helpshort).
Of course, myscript uses all the flags declared by it (in this case,
just --num_replicas) or by any of the modules it transitively imports
(e.g., the modules libfoo, libbar). E.g., it can access the value of
FLAGS.bar_risky_hack, even if --bar_risky_hack is not declared as a key
flag for myscript.
"""
#import cgi
import getopt
import os
import re
import string
import sys
# Are we running at least python 2.2?
try:
if tuple(sys.version_info[:3]) < (2,2,0):
raise NotImplementedError("requires python 2.2.0 or later")
except AttributeError: # a very old python, that lacks sys.version_info
raise NotImplementedError("requires python 2.2.0 or later")
# If we're not running at least python 2.2.1, define True, False, and bool.
# Thanks, Guido, for the code.
try:
True, False, bool
except NameError:
False = 0
True = 1
def bool(x):
if x:
return True
else:
return False
# Are we running under pychecker?
_RUNNING_PYCHECKER = 'pychecker.python' in sys.modules
def _GetCallingModule():
"""Returns the name of the module that's calling into this module.
We generally use this function to get the name of the module calling a
DEFINE_foo... function.
"""
# Walk down the stack to find the first globals dict that's not ours.
for depth in range(1, sys.getrecursionlimit()):
if not sys._getframe(depth).f_globals is globals():
module_name = __GetModuleName(sys._getframe(depth).f_globals)
if module_name is not None:
return module_name
raise AssertionError("No module was found")
# module exceptions:
class FlagsError(Exception):
"""The base class for all flags errors."""
pass
class DuplicateFlag(FlagsError):
"""Raised if there is a flag naming conflict."""
pass
# A DuplicateFlagError conveys more information than a
# DuplicateFlag. Since there are external modules that create
# DuplicateFlags, the interface to DuplicateFlag shouldn't change.
class DuplicateFlagError(DuplicateFlag):
def __init__(self, flagname, flag_values):
self.flagname = flagname
message = "The flag '%s' is defined twice." % self.flagname
flags_by_module = flag_values.FlagsByModuleDict()
for module in flags_by_module:
for flag in flags_by_module[module]:
if flag.name == flagname or flag.short_name == flagname:
message = message + " First from " + module + ","
break
message = message + " Second from " + _GetCallingModule()
DuplicateFlag.__init__(self, message)
class IllegalFlagValue(FlagsError):
"""The flag command line argument is illegal."""
pass
class UnrecognizedFlag(FlagsError):
"""Raised if a flag is unrecognized."""
pass
# An UnrecognizedFlagError conveys more information than an
# UnrecognizedFlag. Since there are external modules that create
# DuplicateFlags, the interface to DuplicateFlag shouldn't change.
class UnrecognizedFlagError(UnrecognizedFlag):
def __init__(self, flagname):
self.flagname = flagname
UnrecognizedFlag.__init__(
self, "Unknown command line flag '%s'" % flagname)
# Global variable used by expvar
_exported_flags = {}
_help_width = 80 # width of help output
def GetHelpWidth():
"""Returns: an integer, the width of help lines that is used in TextWrap."""
return _help_width
def CutCommonSpacePrefix(text):
"""Removes a common space prefix from the lines of a multiline text.
If the first line does not start with a space, it is left as it is and
only in the remaining lines a common space prefix is being searched
for. That means the first line will stay untouched. This is especially
useful to turn doc strings into help texts. This is because some
people prefer to have the doc comment start already after the
apostrophy and then align the following lines while others have the
apostrophies on a seperately line.
The function also drops trailing empty lines and ignores empty lines
following the initial content line while calculating the initial
common whitespace.
Args:
text: text to work on
Returns:
the resulting text
"""
text_lines = text.splitlines()
# Drop trailing empty lines
while text_lines and not text_lines[-1]:
text_lines = text_lines[:-1]
if text_lines:
# We got some content, is the first line starting with a space?
if text_lines[0] and text_lines[0][0].isspace():
text_first_line = []
else:
text_first_line = [text_lines.pop(0)]
# Calculate length of common leading whitesppace (only over content lines)
common_prefix = os.path.commonprefix([line for line in text_lines if line])
space_prefix_len = len(common_prefix) - len(common_prefix.lstrip())
# If we have a common space prefix, drop it from all lines
if space_prefix_len:
for index in xrange(len(text_lines)):
if text_lines[index]:
text_lines[index] = text_lines[index][space_prefix_len:]
return '\n'.join(text_first_line + text_lines)
return ''
def TextWrap(text, length=None, indent='', firstline_indent=None, tabs=' '):
"""Wraps a given text to a maximum line length and returns it.
We turn lines that only contain whitespaces into empty lines. We keep
new lines and tabs (e.g., we do not treat tabs as spaces).
Args:
text: text to wrap
length: maximum length of a line, includes indentation
if this is None then use GetHelpWidth()
indent: indent for all but first line
firstline_indent: indent for first line; if None, fall back to indent
tabs: replacement for tabs
Returns:
wrapped text
Raises:
FlagsError: if indent not shorter than length
FlagsError: if firstline_indent not shorter than length
"""
# Get defaults where callee used None
if length is None:
length = GetHelpWidth()
if indent is None:
indent = ''
if len(indent) >= length:
raise FlagsError('Indent must be shorter than length')
# In line we will be holding the current line which is to be started
# with indent (or firstline_indent if available) and then appended
# with words.
if firstline_indent is None:
firstline_indent = ''
line = indent
else:
line = firstline_indent
if len(firstline_indent) >= length:
raise FlagsError('First iline indent must be shorter than length')
# If the callee does not care about tabs we simply convert them to
# spaces If callee wanted tabs to be single space then we do that
# already here.
if not tabs or tabs == ' ':
text = text.replace('\t', ' ')
else:
tabs_are_whitespace = not tabs.strip()
line_regex = re.compile('([ ]*)(\t*)([^ \t]+)', re.MULTILINE)
# Split the text into lines and the lines with the regex above. The
# resulting lines are collected in result[]. For each split we get the
# spaces, the tabs and the next non white space (e.g. next word).
result = []
for text_line in text.splitlines():
# Store result length so we can find out whether processing the next
# line gave any new content
old_result_len = len(result)
# Process next line with line_regex. For optimization we do an rstrip().
# - process tabs (changes either line or word, see below)
# - process word (first try to squeeze on line, then wrap or force wrap)
# Spaces found on the line are ignored, they get added while wrapping as
# needed.
for spaces, current_tabs, word in line_regex.findall(text_line.rstrip()):
# If tabs weren't converted to spaces, handle them now
if current_tabs:
# If the last thing we added was a space anyway then drop
# it. But let's not get rid of the indentation.
if (((result and line != indent) or
(not result and line != firstline_indent)) and line[-1] == ' '):
line = line[:-1]
# Add the tabs, if that means adding whitespace, just add it at
# the line, the rstrip() code while shorten the line down if
# necessary
if tabs_are_whitespace:
line += tabs * len(current_tabs)
else:
# if not all tab replacement is whitespace we prepend it to the word
word = tabs * len(current_tabs) + word
# Handle the case where word cannot be squeezed onto current last line
if len(line) + len(word) > length and len(indent) + len(word) <= length:
result.append(line.rstrip())
line = indent + word
word = ''
# No space left on line or can we append a space?
if len(line) + 1 >= length:
result.append(line.rstrip())
line = indent
else:
line += ' '
# Add word and shorten it up to allowed line length. Restart next
# line with indent and repeat, or add a space if we're done (word
# finished) This deals with words that caanot fit on one line
# (e.g. indent + word longer than allowed line length).
while len(line) + len(word) >= length:
line += word
result.append(line[:length])
word = line[length:]
line = indent
# Default case, simply append the word and a space
if word:
line += word + ' '
# End of input line. If we have content we finish the line. If the
# current line is just the indent but we had content in during this
# original line then we need to add an emoty line.
if (result and line != indent) or (not result and line != firstline_indent):
result.append(line.rstrip())
elif len(result) == old_result_len:
result.append('')
line = indent
return '\n'.join(result)
def DocToHelp(doc):
"""Takes a __doc__ string and reformats it as help."""
# Get rid of starting and ending white space. Using lstrip() or even
# strip() could drop more than maximum of first line and right space
# of last line.
doc = doc.strip()
# Get rid of all empty lines
whitespace_only_line = re.compile('^[ \t]+$', re.M)
doc = whitespace_only_line.sub('', doc)
# Cut out common space at line beginnings
doc = CutCommonSpacePrefix(doc)
# Just like this module's comment, comments tend to be aligned somehow.
# In other words they all start with the same amount of white space
# 1) keep double new lines
# 2) keep ws after new lines if not empty line
# 3) all other new lines shall be changed to a space
# Solution: Match new lines between non white space and replace with space.
doc = re.sub('(?<=\S)\n(?=\S)', ' ', doc, re.M)
return doc
def __GetModuleName(globals_dict):
"""Given a globals dict, returns the name of the module that defines it.
Args:
globals_dict: A dictionary that should correspond to an environment
providing the values of the globals.
Returns:
A string (the name of the module) or None (if the module could not
be identified.
"""
for name, module in sys.modules.iteritems():
if getattr(module, '__dict__', None) is globals_dict:
if name == '__main__':
return sys.argv[0]
return name
return None
def _GetMainModule():
"""Returns the name of the module from which execution started."""
for depth in range(1, sys.getrecursionlimit()):
try:
globals_of_main = sys._getframe(depth).f_globals
except ValueError:
return __GetModuleName(globals_of_main)
raise AssertionError("No module was found")
# lhuang: main entry here
class FlagValues:
"""Registry of 'Flag' objects.
A 'FlagValues' can then scan command line arguments, passing flag
arguments through to the 'Flag' objects that it owns. It also
provides easy access to the flag values. Typically only one
'FlagValues' object is needed by an application: gflags.FLAGS
This class is heavily overloaded:
'Flag' objects are registered via __setitem__:
FLAGS['longname'] = x # register a new flag
The .value attribute of the registered 'Flag' objects can be accessed
as attributes of this 'FlagValues' object, through __getattr__. Both
the long and short name of the original 'Flag' objects can be used to
access its value:
FLAGS.longname # parsed flag value
FLAGS.x # parsed flag value (short name)
Command line arguments are scanned and passed to the registered 'Flag'
objects through the __call__ method. Unparsed arguments, including
argv[0] (e.g. the program name) are returned.
argv = FLAGS(sys.argv) # scan command line arguments
The original registered Flag objects can be retrieved through the use
of the dictionary-like operator, __getitem__:
x = FLAGS['longname'] # access the registered Flag object
The str() operator of a 'FlagValues' object provides help for all of
the registered 'Flag' objects.
"""
def __init__(self):
# Since everything in this class is so heavily overloaded, the only
# way of defining and using fields is to access __dict__ directly.
# Dictionary: flag name (string) -> Flag object.
self.__dict__['__flags'] = {}
# Dictionary: module name (string) -> list of Flag objects that are defined
# by that module.
self.__dict__['__flags_by_module'] = {}
# Dictionary: module name (string) -> list of Flag objects that are
# key for that module.
self.__dict__['__key_flags_by_module'] = {}
def FlagDict(self):
return self.__dict__['__flags']
def FlagsByModuleDict(self):
"""Returns the dictionary of module_name -> list of defined flags.
Returns:
A dictionary. Its keys are module names (strings). Its values
are lists of Flag objects.
"""
return self.__dict__['__flags_by_module']
def KeyFlagsByModuleDict(self):
"""Returns the dictionary of module_name -> list of key flags.
Returns:
A dictionary. Its keys are module names (strings). Its values
are lists of Flag objects.
"""
return self.__dict__['__key_flags_by_module']
def _RegisterFlagByModule(self, module_name, flag):
"""Records the module that defines a specific flag.
We keep track of which flag is defined by which module so that we
can later sort the flags by module.
Args:
module_name: A string, the name of a Python module.
flag: A Flag object, a flag that is key to the module.
"""
flags_by_module = self.FlagsByModuleDict()
flags_by_module.setdefault(module_name, []).append(flag)
def _RegisterKeyFlagForModule(self, module_name, flag):
"""Specifies that a flag is a key flag for a module.
Args:
module_name: A string, the name of a Python module.
flag: A Flag object, a flag that is key to the module.
"""
key_flags_by_module = self.KeyFlagsByModuleDict()
# The list of key flags for the module named module_name.
key_flags = key_flags_by_module.setdefault(module_name, [])
# Add flag, but avoid duplicates.
if flag not in key_flags:
key_flags.append(flag)
def _GetFlagsDefinedByModule(self, module):
"""Returns the list of flags defined by a module.
Args:
module: A module object or a module name (a string).
Returns:
A new list of Flag objects. Caller may update this list as he
wishes: none of those changes will affect the internals of this
FlagValue object.
"""
if not isinstance(module, str):
module = module.__name__
return list(self.FlagsByModuleDict().get(module, []))
def _GetKeyFlagsForModule(self, module):
"""Returns the list of key flags for a module.
Args:
module: A module object or a module name (a string)
Returns:
A new list of Flag objects. Caller may update this list as he
wishes: none of those changes will affect the internals of this
FlagValue object.
"""
if not isinstance(module, str):
module = module.__name__
# Any flag is a key flag for the module that defined it. NOTE:
# key_flags is a fresh list: we can update it without affecting the
# internals of this FlagValues object.
key_flags = self._GetFlagsDefinedByModule(module)
# Take into account flags explicitly declared as key for a module.
for flag in self.KeyFlagsByModuleDict().get(module, []):
if flag not in key_flags:
key_flags.append(flag)
return key_flags
def AppendFlagValues(self, flag_values):
"""Appends flags registered in another FlagValues instance.
Args:
flag_values: registry to copy from
"""
for flag_name, flag in flag_values.FlagDict().iteritems():
# Each flags with shortname appears here twice (once under its
# normal name, and again with its short name). To prevent
# problems (DuplicateFlagError) with double flag registration, we
# perform a check to make sure that the entry we're looking at is
# for its normal name.
if flag_name == flag.name:
self[flag_name] = flag
def __setitem__(self, name, flag):
"""Registers a new flag variable."""
fl = self.FlagDict()
if not isinstance(flag, Flag):
raise IllegalFlagValue(flag)
if not isinstance(name, type("")):
raise FlagsError("Flag name must be a string")
if len(name) == 0:
raise FlagsError("Flag name cannot be empty")
# If running under pychecker, duplicate keys are likely to be
# defined. Disable check for duplicate keys when pycheck'ing.
if (fl.has_key(name) and not flag.allow_override and
not fl[name].allow_override and not _RUNNING_PYCHECKER):
raise DuplicateFlagError(name, self)
short_name = flag.short_name
if short_name is not None:
if (fl.has_key(short_name) and not flag.allow_override and
not fl[short_name].allow_override and not _RUNNING_PYCHECKER):
raise DuplicateFlagError(short_name, self)
fl[short_name] = flag
fl[name] = flag
global _exported_flags
_exported_flags[name] = flag
def __getitem__(self, name):
"""Retrieves the Flag object for the flag --name."""
return self.FlagDict()[name]
def __getattr__(self, name):
"""Retrieves the 'value' attribute of the flag --name."""
fl = self.FlagDict()
if not fl.has_key(name):
raise AttributeError(name)
return fl[name].value
def __setattr__(self, name, value):
"""Sets the 'value' attribute of the flag --name."""
fl = self.FlagDict()
fl[name].value = value
return value
def _FlagIsRegistered(self, flag_obj):
"""Checks whether a Flag object is registered under some name.
Note: this is non trivial: in addition to its normal name, a flag
may have a short name too. In self.FlagDict(), both the normal and
the short name are mapped to the same flag object. E.g., calling
only "del FLAGS.short_name" is not unregistering the corresponding
Flag object (it is still registered under the longer name).
Args:
flag_obj: A Flag object.
Returns:
A boolean: True iff flag_obj is registered under some name.
"""
flag_dict = self.FlagDict()
# Check whether flag_obj is registered under its long name.
name = flag_obj.name
if flag_dict.get(name, None) == flag_obj:
return True
# Check whether flag_obj is registered under its short name.
short_name = flag_obj.short_name
if (short_name is not None and
flag_dict.get(short_name, None) == flag_obj):
return True
# The flag cannot be registered under any other name, so we do not
# need to do a full search through the values of self.FlagDict().
return False
def __delattr__(self, flag_name):
"""Deletes a previously-defined flag from a flag object.
This method makes sure we can delete a flag by using
del flag_values_object.<flag_name>
E.g.,
flags.DEFINE_integer('foo', 1, 'Integer flag.')
del flags.FLAGS.foo
Args:
flag_name: A string, the name of the flag to be deleted.
Raises:
AttributeError: When there is no registered flag named flag_name.
"""
fl = self.FlagDict()
if flag_name not in fl:
raise AttributeError(flag_name)
flag_obj = fl[flag_name]
del fl[flag_name]
if not self._FlagIsRegistered(flag_obj):
# If the Flag object indicated by flag_name is no longer
# registered (please see the docstring of _FlagIsRegistered), then
# we delete the occurences of the flag object in all our internal
# dictionaries.
self.__RemoveFlagFromDictByModule(self.FlagsByModuleDict(), flag_obj)
self.__RemoveFlagFromDictByModule(self.KeyFlagsByModuleDict(), flag_obj)
def __RemoveFlagFromDictByModule(self, flags_by_module_dict, flag_obj):
"""Removes a flag object from a module -> list of flags dictionary.
Args:
flags_by_module_dict: A dictionary that maps module names to lists of
flags.
flag_obj: A flag object.
"""
for unused_module, flags_in_module in flags_by_module_dict.iteritems():
# while (as opposed to if) takes care of multiple occurences of a
# flag in the list for the same module.
while flag_obj in flags_in_module:
flags_in_module.remove(flag_obj)
def SetDefault(self, name, value):
"""Changes the default value of the named flag object."""
fl = self.FlagDict()
if not fl.has_key(name):
raise AttributeError(name)
fl[name].SetDefault(value)
def __contains__(self, name):
"""Returns True if name is a value (flag) in the dict."""
return name in self.FlagDict()
has_key = __contains__ # a synonym for __contains__()
def __iter__(self):
return self.FlagDict().iterkeys()
# lhuang: my stealthy entry point
def __call__(self, argv):
try:
# N.B.: return the rest of the command-line! (non-flag arguments)
return self.__call2__(argv)
except FlagsError, e:
# lhuang: to 2> instead of >
import sys
print >> sys.stderr, 'Error: %s\nUsage: %s [flags]\n%s' % (e, list(argv)[0], FLAGS)
sys.exit(1)
# lhuang: external entry FLAGS(sys.argv) here
def __call2__(self, argv):
"""Parses flags from argv; stores parsed flags into this FlagValues object.
All unparsed arguments are returned. Flags are parsed using the GNU
Program Argument Syntax Conventions, using getopt:
http://www.gnu.org/software/libc/manual/html_mono/libc.html#Getopt
Args:
argv: argument list. Can be of any type that may be converted to a list.
Returns:
The list of arguments not parsed as options, including argv[0]
Raises:
FlagsError: on any parsing error
"""
# Support any sequence type that can be converted to a list
argv = list(argv)
shortopts = ""
longopts = []
fl = self.FlagDict()
# This pre parses the argv list for --flagfile=<> options.
argv = self.ReadFlagsFromFiles(argv)
# Correct the argv to support the google style of passing boolean
# parameters. Boolean parameters may be passed by using --mybool,
# --nomybool, --mybool=(true|false|1|0). getopt does not support
# having options that may or may not have a parameter. We replace
# instances of the short form --mybool and --nomybool with their
# full forms: --mybool=(true|false).
original_argv = list(argv) # list() makes a copy
shortest_matches = None
for name, flag in fl.items():
if not flag.boolean:
continue
if shortest_matches is None:
# Determine the smallest allowable prefix for all flag names
shortest_matches = self.ShortestUniquePrefixes(fl)
no_name = 'no' + name
prefix = shortest_matches[name]
no_prefix = shortest_matches[no_name]
# Replace all occurences of this boolean with extended forms
for arg_idx in range(1, len(argv)):
arg = argv[arg_idx]
if arg.find('=') >= 0: continue
if arg.startswith('--'+prefix) and ('--'+name).startswith(arg):
argv[arg_idx] = ('--%s=true' % name)
elif arg.startswith('--'+no_prefix) and ('--'+no_name).startswith(arg):
argv[arg_idx] = ('--%s=false' % name)
# Loop over all of the flags, building up the lists of short options
# and long options that will be passed to getopt. Short options are
# specified as a string of letters, each letter followed by a colon
# if it takes an argument. Long options are stored in an array of
# strings. Each string ends with an '=' if it takes an argument.
for name, flag in fl.items():
longopts.append(name + "=")
if len(name) == 1: # one-letter option: allow short flag type also
shortopts += name
if not flag.boolean:
shortopts += ":"
longopts.append('undefok=')
undefok_flags = []
# In case --undefok is specified, loop to pick up unrecognized
# options one by one.
unrecognized_opts = []
args = argv[1:]
while True:
try:
optlist, unparsed_args = getopt.gnu_getopt(args, shortopts, longopts)
break
except getopt.GetoptError, e:
if not e.opt or e.opt in fl:
# Not an unrecognized option, reraise the exception as a FlagsError
raise FlagsError(e)
# Handle an unrecognized option.
unrecognized_opts.append(e.opt)
# Remove offender from args and try again
for arg_index in range(len(args)):
if ((args[arg_index] == '--' + e.opt) or
(args[arg_index] == '-' + e.opt) or
args[arg_index].startswith('--' + e.opt + '=')):
args = args[0:arg_index] + args[arg_index+1:]
break
else:
# We should have found the option, so we don't expect to get
# here. We could assert, but raising the original exception
# might work better.
raise FlagsError(e)
for name, arg in optlist:
if name == '--undefok':
flag_names = arg.split(',')
undefok_flags.extend(flag_names)
# For boolean flags, if --undefok=boolflag is specified, then we should
# also accept --noboolflag, in addition to --boolflag.
# Since we don't know the type of the undefok'd flag, this will affect
# non-boolean flags as well.
# NOTE: You shouldn't use --undefok=noboolflag, because then we will
# accept --nonoboolflag here. We are choosing not to do the conversion
# from noboolflag -> boolflag because of the ambiguity that flag names
# can start with 'no'.
undefok_flags.extend('no' + name for name in flag_names)
continue
if name.startswith('--'):
# long option
name = name[2:]
short_option = 0
else:
# short option
name = name[1:]
short_option = 1
if fl.has_key(name):
flag = fl[name]
if flag.boolean and short_option: arg = 1
flag.Parse(arg)
# If there were unrecognized options, raise an exception unless
# the options were named via --undefok.
for opt in unrecognized_opts:
if opt not in undefok_flags:
raise UnrecognizedFlagError(opt)
if unparsed_args:
# unparsed_args becomes the first non-flag detected by getopt to
# the end of argv. Because argv may have been modified above,
# return original_argv for this region.
return argv[:1] + original_argv[-len(unparsed_args):]
else:
return argv[:1]
def Reset(self):
"""Resets the values to the point before FLAGS(argv) was called."""
for f in self.FlagDict().values():
f.Unparse()
def RegisteredFlags(self):
"""Returns: a list of the names and short names of all registered flags."""
return self.FlagDict().keys()
def FlagValuesDict(self):
"""Returns: a dictionary that maps flag names to flag values."""
flag_values = {}
for flag_name in self.RegisteredFlags():
flag = self.FlagDict()[flag_name]
flag_values[flag_name] = flag.value
return flag_values
def __str__(self):
"""Generates a help string for all known flags."""
return self.GetHelp()
def GetHelp(self, prefix=''):
"""Generates a help string for all known flags."""
helplist = []
flags_by_module = self.FlagsByModuleDict()
if flags_by_module:
modules = flags_by_module.keys()
modules.sort()
# Print the help for the main module first, if possible.
main_module = _GetMainModule()
if main_module in modules:
modules.remove(main_module)
modules = [main_module] + modules
for module in modules:
self.__RenderOurModuleFlags(module, helplist)
self.__RenderModuleFlags('gflags',
_SPECIAL_FLAGS.FlagDict().values(),
helplist)
else:
# Just print one long list of flags.
self.__RenderFlagList(
self.FlagDict().values() + _SPECIAL_FLAGS.FlagDict().values(),
helplist, prefix)
return '\n'.join(helplist)
def __RenderModuleFlags(self, module, flags, output_lines, prefix=""):
"""Generates a help string for a given module."""
# output_lines.append('\n%s%s:' % (prefix, module))
self.__RenderFlagList(flags, output_lines, prefix + " ")
def __RenderOurModuleFlags(self, module, output_lines, prefix=""):
"""Generates a help string for a given module."""
flags = self._GetFlagsDefinedByModule(module)
if flags:
self.__RenderModuleFlags(module, flags, output_lines, prefix)
def __RenderOurModuleKeyFlags(self, module, output_lines, prefix=""):
"""Generates a help string for the key flags of a given module.
Args:
module: A module object or a module name (a string).
output_lines: A list of strings. The generated help message
lines will be appended to this list.
prefix: A string that is prepended to each generated help line.
"""
key_flags = self._GetKeyFlagsForModule(module)
if key_flags:
self.__RenderModuleFlags(module, key_flags, output_lines, prefix)
def MainModuleHelp(self):
"""Returns: A string describing the key flags of the main module."""
helplist = []
self.__RenderOurModuleKeyFlags(_GetMainModule(), helplist)
return '\n'.join(helplist)
def __RenderFlagList(self, flaglist, output_lines, prefix=" "):
fl = self.FlagDict()
special_fl = _SPECIAL_FLAGS.FlagDict()
flaglist = [(flag.name, flag) for flag in flaglist]
flaglist.sort()
flagset = {}
for (name, flag) in flaglist:
# It's possible this flag got deleted or overridden since being
# registered in the per-module flaglist. Check now against the
# canonical source of current flag information, the FlagDict.
if fl.get(name, None) != flag and special_fl.get(name, None) != flag:
# a different flag is using this name now
continue
# only print help once
if flagset.has_key(flag): continue
flagset[flag] = 1
flaghelp = ""
# lhuang:
if flag.name in ["help", "helpshort"]:
continue
if flag.short_name:
flaghelp += "-" if len(flag.short_name) == 1 else "--" # lhuang: shortname can be long
flaghelp += "%s," % flag.short_name
if flag.boolean:
flaghelp += "--[no]%s" % flag.name + ":"
else:
flaghelp += "--%s" % flag.name + ":"
flaghelp += " "
if flag.help:
flaghelp += flag.help
flaghelp = TextWrap(flaghelp, indent=prefix+" ",
firstline_indent=prefix)
if flag.default_as_str:
flaghelp += "\n" # lhuang
flaghelp += TextWrap("(default: %s)" % flag.default_as_str,
indent=prefix+" ")
if flag.parser.syntactic_help:
flaghelp += "\t" # lhuang
flaghelp += TextWrap("(%s)" % flag.parser.syntactic_help,
indent=prefix+" ")
output_lines.append(flaghelp)
def get(self, name, default):
"""Returns the value of a flag (if not None) or a default value.
Args:
name: A string, the name of a flag.
default: Default value to use if the flag value is None.
"""
value = self.__getattr__(name)
if value is not None: # Can't do if not value, b/c value might be '0' or ""
return value
else:
return default
def ShortestUniquePrefixes(self, fl):
"""Returns: dictionary; maps flag names to their shortest unique prefix."""
# Sort the list of flag names
sorted_flags = []
for name, flag in fl.items():
sorted_flags.append(name)
if flag.boolean:
sorted_flags.append('no%s' % name)
sorted_flags.sort()
# For each name in the sorted list, determine the shortest unique
# prefix by comparing itself to the next name and to the previous
# name (the latter check uses cached info from the previous loop).
shortest_matches = {}
prev_idx = 0
for flag_idx in range(len(sorted_flags)):
curr = sorted_flags[flag_idx]
if flag_idx == (len(sorted_flags) - 1):
next = None
else:
next = sorted_flags[flag_idx+1]
next_len = len(next)
for curr_idx in range(len(curr)):
if (next is None
or curr_idx >= next_len
or curr[curr_idx] != next[curr_idx]):
# curr longer than next or no more chars in common
shortest_matches[curr] = curr[:max(prev_idx, curr_idx) + 1]
prev_idx = curr_idx
break
else:
# curr shorter than (or equal to) next
shortest_matches[curr] = curr
prev_idx = curr_idx + 1 # next will need at least one more char
return shortest_matches
def __IsFlagFileDirective(self, flag_string):
"""Checks whether flag_string contain a --flagfile=<foo> directive."""
if isinstance(flag_string, type("")):
if flag_string.startswith('--flagfile='):
return 1
elif flag_string == '--flagfile':
return 1
elif flag_string.startswith('-flagfile='):
return 1
elif flag_string == '-flagfile':
return 1
else:
return 0
return 0
def ExtractFilename(self, flagfile_str):
"""Returns filename from a flagfile_str of form -[-]flagfile=filename.
The cases of --flagfile foo and -flagfile foo shouldn't be hitting
this function, as they are dealt with in the level above this
function.
"""
if flagfile_str.startswith('--flagfile='):
return os.path.expanduser((flagfile_str[(len('--flagfile=')):]).strip())
elif flagfile_str.startswith('-flagfile='):
return os.path.expanduser((flagfile_str[(len('-flagfile=')):]).strip())
else:
raise FlagsError('Hit illegal --flagfile type: %s' % flagfile_str)
def __GetFlagFileLines(self, filename, parsed_file_list):
"""Returns the useful (!=comments, etc) lines from a file with flags.
Args:
filename: A string, the name of the flag file.
parsed_file_list: A list of the names of the files we have
already read. MUTATED BY THIS FUNCTION.
Returns:
List of strings. See the note below.
NOTE(springer): This function checks for a nested --flagfile=<foo>
tag and handles the lower file recursively. It returns a list of
all the lines that _could_ contain command flags. This is
EVERYTHING except whitespace lines and comments (lines starting
with '#' or '//').
"""
line_list = [] # All line from flagfile.
flag_line_list = [] # Subset of lines w/o comments, blanks, flagfile= tags.
try:
file_obj = open(filename, 'r')
except IOError, e_msg:
print e_msg
print 'ERROR:: Unable to open flagfile: %s' % (filename)
return flag_line_list
line_list = file_obj.readlines()
file_obj.close()
parsed_file_list.append(filename)
# This is where we check each line in the file we just read.
for line in line_list:
if line.isspace():
pass
# Checks for comment (a line that starts with '#').
elif line.startswith('#') or line.startswith('//'):
pass
# Checks for a nested "--flagfile=<bar>" flag in the current file.
# If we find one, recursively parse down into that file.
elif self.__IsFlagFileDirective(line):
sub_filename = self.ExtractFilename(line)
# We do a little safety check for reparsing a file we've already done.
if not sub_filename in parsed_file_list:
included_flags = self.__GetFlagFileLines(sub_filename,
parsed_file_list)
flag_line_list.extend(included_flags)
else: # Case of hitting a circularly included file.
print >>sys.stderr, ('Warning: Hit circular flagfile dependency: %s'
% sub_filename)
else:
# Any line that's not a comment or a nested flagfile should get
# copied into 2nd position. This leaves earlier arguements
# further back in the list, thus giving them higher priority.
flag_line_list.append(line.strip())
return flag_line_list
def ReadFlagsFromFiles(self, argv):
"""Processes command line args, but also allow args to be read from file.
Args:
argv: A list of strings, usually sys.argv, which may contain one
or more flagfile directives of the form --flagfile="./filename".
Returns:
A new list which has the original list combined with what we read
from any flagfile(s).
References: Global gflags.FLAG class instance.
This function should be called before the normal FLAGS(argv) call.
This function scans the input list for a flag that looks like:
--flagfile=<somefile>. Then it opens <somefile>, reads all valid key
and value pairs and inserts them into the input list between the
first item of the list and any subsequent items in the list.
Note that your application's flags are still defined the usual way
using gflags DEFINE_flag() type functions.
Notes (assuming we're getting a commandline of some sort as our input):
--> Flags from the command line argv _should_ always take precedence!
--> A further "--flagfile=<otherfile.cfg>" CAN be nested in a flagfile.
It will be processed after the parent flag file is done.
--> For duplicate flags, first one we hit should "win".
--> In a flagfile, a line beginning with # or // is a comment.
--> Entirely blank lines _should_ be ignored.
"""
parsed_file_list = []
rest_of_args = argv
new_argv = []
while rest_of_args:
current_arg = rest_of_args[0]
rest_of_args = rest_of_args[1:]
if self.__IsFlagFileDirective(current_arg):
# This handles the case of -(-)flagfile foo. In this case the
# next arg really is part of this one.
if current_arg == '--flagfile' or current_arg == '-flagfile':
if not rest_of_args:
raise IllegalFlagValue('--flagfile with no argument')
flag_filename = os.path.expanduser(rest_of_args[0])
rest_of_args = rest_of_args[1:]
else:
# This handles the case of (-)-flagfile=foo.
flag_filename = self.ExtractFilename(current_arg)
new_argv = (new_argv[:1] +
self.__GetFlagFileLines(flag_filename, parsed_file_list) +
new_argv[1:])
else:
new_argv.append(current_arg)
return new_argv
def FlagsIntoString(self):
"""Returns a string with the flags assignments from this FlagValues object.
This function ignores flags whose value is None. Each flag
assignment is separated by a newline.
NOTE: MUST mirror the behavior of the C++ function
CommandlineFlagsIntoString from google3/base/commandlineflags.cc.
"""
s = ''
for flag in self.FlagDict().values():
if flag.value is not None:
s += flag.Serialize() + '\n'
return s
def AppendFlagsIntoFile(self, filename):
"""Appends all flags assignments from this FlagInfo object to a file.
Output will be in the format of a flagfile.
NOTE: MUST mirror the behavior of the C++ version of
AppendFlagsIntoFile from google3/base/commandlineflags.cc.
"""
out_file = open(filename, 'a')
out_file.write(self.FlagsIntoString())
out_file.close()
def WriteHelpInXMLFormat(self, outfile=None):
"""Outputs flag documentation in XML format.
NOTE: We use element names that are consistent with those used by
the C++ command-line flag library, from
google3/base/commandlineflags_reporting.cc. We also use a few new
elements (e.g., <key>), but we do not interfere / overlap with
existing XML elements used by the C++ library. Please maintain this
consistency.
Args:
outfile: File object we write to. Default None means sys.stdout.
"""
outfile = outfile or sys.stdout
outfile.write('<?xml version=\"1.0\"?>\n')
outfile.write('<AllFlags>\n')
indent = ' '
_WriteSimpleXMLElement(outfile, 'program', os.path.basename(sys.argv[0]),
indent)
usage_doc = sys.modules['__main__'].__doc__
if not usage_doc:
usage_doc = '\nUSAGE: %s [flags]\n' % sys.argv[0]
else:
usage_doc = usage_doc.replace('%s', sys.argv[0])
_WriteSimpleXMLElement(outfile, 'usage', usage_doc, indent)
# Get list of key flags for the main module.
key_flags = self._GetKeyFlagsForModule(_GetMainModule())
# Sort flags by declaring module name and next by flag name.
flags_by_module = self.FlagsByModuleDict()
all_module_names = list(flags_by_module.keys())
all_module_names.sort()
for module_name in all_module_names:
flag_list = [(f.name, f) for f in flags_by_module[module_name]]
flag_list.sort()
for unused_flag_name, flag in flag_list:
is_key = flag in key_flags
flag.WriteInfoInXMLFormat(outfile, module_name,
is_key=is_key, indent=indent)
outfile.write('</AllFlags>\n')
outfile.flush()
# end of FlagValues definition
# The global FlagValues instance //lhuang
FLAGS = FlagValues()
def _MakeXMLSafe(s):
"""Escapes <, >, and & from s, and removes XML 1.0-illegal chars."""
# lhuang: avoid _md5
s = s #cgi.escape(s) # Escape <, >, and &
# Remove characters that cannot appear in an XML 1.0 document
# (http://www.w3.org/TR/REC-xml/#charsets).
#
# NOTE: if there are problems with current solution, one may move to
# XML 1.1, which allows such chars, if they're entity-escaped (&#xHH;).
s = re.sub(r'[\x00-\x08\x0b\x0c\x0e-\x1f]', '', s)
return s
def _WriteSimpleXMLElement(outfile, name, value, indent):
"""Writes a simple XML element.
Args:
outfile: File object we write the XML element to.
name: A string, the name of XML element.
value: A Python object, whose string representation will be used
as the value of the XML element.
indent: A string, prepended to each line of generated output.
"""
value_str = str(value)
if isinstance(value, bool):
# Display boolean values as the C++ flag library does: no caps.
value_str = value_str.lower()
outfile.write('%s<%s>%s</%s>\n' %
(indent, name, _MakeXMLSafe(value_str), name))
class Flag:
"""Information about a command-line flag.
'Flag' objects define the following fields:
.name - the name for this flag
.default - the default value for this flag
.default_as_str - default value as repr'd string, e.g., "'true'" (or None)
.value - the most recent parsed value of this flag; set by Parse()
.help - a help string or None if no help is available
.short_name - the single letter alias for this flag (or None)
.boolean - if 'true', this flag does not accept arguments
.present - true if this flag was parsed from command line flags.
.parser - an ArgumentParser object
.serializer - an ArgumentSerializer object
.allow_override - the flag may be redefined without raising an error
The only public method of a 'Flag' object is Parse(), but it is
typically only called by a 'FlagValues' object. The Parse() method is
a thin wrapper around the 'ArgumentParser' Parse() method. The parsed
value is saved in .value, and the .present attribute is updated. If
this flag was already present, a FlagsError is raised.
Parse() is also called during __init__ to parse the default value and
initialize the .value attribute. This enables other python modules to
safely use flags even if the __main__ module neglects to parse the
command line arguments. The .present attribute is cleared after
__init__ parsing. If the default value is set to None, then the
__init__ parsing step is skipped and the .value attribute is
initialized to None.
Note: The default value is also presented to the user in the help
string, so it is important that it be a legal value for this flag.
"""
def __init__(self, parser, serializer, name, default, help_string,
short_name=None, boolean=0, allow_override=0):
self.name = name
if not help_string:
help_string = '(no help available)'
self.help = help_string
self.short_name = short_name
self.boolean = boolean
self.present = 0
self.parser = parser
self.serializer = serializer
self.allow_override = allow_override
self.value = None
self.SetDefault(default)
def __GetParsedValueAsString(self, value):
if value is None:
return None
if self.serializer:
return repr(self.serializer.Serialize(value))
if self.boolean:
if value:
return repr('true')
else:
return repr('false')
return repr(str(value))
def Parse(self, argument):
try:
self.value = self.parser.Parse(argument)
except ValueError, e: # recast ValueError as IllegalFlagValue
raise IllegalFlagValue("flag --%s: %s" % (self.name, e))
self.present += 1
def Unparse(self):
if self.default is None:
self.value = None
else:
self.Parse(self.default)
self.present = 0
def Serialize(self):
if self.value is None:
return ''
if self.boolean:
if self.value:
return "--%s" % self.name
else:
return "--no%s" % self.name
else:
if not self.serializer:
raise FlagsError("Serializer not present for flag %s" % self.name)
return "--%s=%s" % (self.name, self.serializer.Serialize(self.value))
def SetDefault(self, value):
"""Changes the default value (and current value too) for this Flag."""
# We can't allow a None override because it may end up not being
# passed to C++ code when we're overriding C++ flags. So we
# cowardly bail out until someone fixes the semantics of trying to
# pass None to a C++ flag. See swig_flags.Init() for details on
# this behavior.
if value is None and self.allow_override:
raise DuplicateFlag(self.name)
self.default = value
self.Unparse()
self.default_as_str = self.__GetParsedValueAsString(self.value)
def Type(self):
"""Returns: a string that describes the type of this Flag."""
# NOTE: we use strings, and not the types.*Type constants because
# our flags can have more exotic types, e.g., 'comma separated list
# of strings', 'whitespace separated list of strings', etc.
return self.parser.Type()
def WriteInfoInXMLFormat(self, outfile, module_name, is_key=False, indent=''):
"""Writes common info about this flag, in XML format.
This is information that is relevant to all flags (e.g., name,
meaning, etc.). If you defined a flag that has some other pieces of
info, then please override _WriteCustomInfoInXMLFormat.
Please do NOT override this method.
Args:
outfile: File object we write to.
module_name: A string, the name of the module that defines this flag.
is_key: A boolean, True iff this flag is key for main module.
indent: A string that is prepended to each generated line.
"""
outfile.write(indent + '<flag>\n')
inner_indent = indent + ' '
if is_key:
_WriteSimpleXMLElement(outfile, 'key', 'yes', inner_indent)
_WriteSimpleXMLElement(outfile, 'file', module_name, inner_indent)
# Print flag features that are relevant for all flags.
_WriteSimpleXMLElement(outfile, 'name', self.name, inner_indent)
if self.short_name:
_WriteSimpleXMLElement(outfile, 'short_name', self.short_name,
inner_indent)
if self.help:
_WriteSimpleXMLElement(outfile, 'meaning', self.help, inner_indent)
_WriteSimpleXMLElement(outfile, 'default', self.default, inner_indent)
_WriteSimpleXMLElement(outfile, 'current', self.value, inner_indent)
_WriteSimpleXMLElement(outfile, 'type', self.Type(), inner_indent)
# Print extra flag features this flag may have.
self._WriteCustomInfoInXMLFormat(outfile, inner_indent)
outfile.write(indent + '</flag>\n')
def _WriteCustomInfoInXMLFormat(self, outfile, indent):
"""Writes extra info about this flag, in XML format.
"Extra" means "not already printed by WriteInfoInXMLFormat above."
Args:
outfile: File object we write to.
indent: A string that is prepended to each generated line.
"""
# Usually, the parser knows the extra details about the flag, so
# we just forward the call to it.
self.parser.WriteCustomInfoInXMLFormat(outfile, indent)
# End of Flag definition
class ArgumentParser:
"""Base class used to parse and convert arguments.
The Parse() method checks to make sure that the string argument is a
legal value and convert it to a native type. If the value cannot be
converted, it should throw a 'ValueError' exception with a human
readable explanation of why the value is illegal.
Subclasses should also define a syntactic_help string which may be
presented to the user to describe the form of the legal values.
"""
syntactic_help = ""
def Parse(self, argument):
"""Default implementation: always returns its argument unmodified."""
return argument
def Type(self):
return 'string'
def WriteCustomInfoInXMLFormat(self, outfile, indent):
pass
class ArgumentSerializer:
"""Base class for generating string representations of a flag value."""
def Serialize(self, value):
return str(value)
class ListSerializer(ArgumentSerializer):
def __init__(self, list_sep):
self.list_sep = list_sep
def Serialize(self, value):
return self.list_sep.join([str(x) for x in value])
# The DEFINE functions are explained in mode details in the module doc string.
def DEFINE(parser, name, default, help, flag_values=FLAGS, serializer=None,
**args):
"""Registers a generic Flag object.
NOTE: in the docstrings of all DEFINE* functions, "registers" is short
for "creates a new flag and registers it".
Auxiliary function: clients should use the specialized DEFINE_<type>
function instead.
Args:
parser: ArgumentParser that is used to parse the flag arguments.
name: A string, the flag name.
default: The default value of the flag.
help: A help string.
flag_values: FlagValues object the flag will be registered with.
serializer: ArgumentSerializer that serializes the flag value.
args: Dictionary with extra keyword args that are passes to the
Flag __init__.
"""
DEFINE_flag(Flag(parser, serializer, name, default, help, **args),
flag_values)
def DEFINE_flag(flag, flag_values=FLAGS):
"""Registers a 'Flag' object with a 'FlagValues' object.
By default, the global FLAGS 'FlagValue' object is used.
Typical users will use one of the more specialized DEFINE_xxx
functions, such as DEFINE_string or DEFINE_integer. But developers
who need to create Flag objects themselves should use this function
to register their flags.
"""
# copying the reference to flag_values prevents pychecker warnings
fv = flag_values
fv[flag.name] = flag
# Tell flag_values who's defining the flag.
if isinstance(flag_values, FlagValues):
# Regarding the above isinstance test: some users pass funny
# values of flag_values (e.g., {}) in order to avoid the flag
# registration (in the past, there used to be a flag_values ==
# FLAGS test here) and redefine flags with the same name (e.g.,
# debug). To avoid breaking their code, we perform the
# registration only if flag_values is a real FlagValues object.
flag_values._RegisterFlagByModule(_GetCallingModule(), flag)
def _InternalDeclareKeyFlags(flag_names, flag_values=FLAGS):
"""Declares a flag as key for the calling module.
Internal function. User code should call DECLARE_key_flag or
ADOPT_module_key_flags instead.
Args:
flag_names: A list of strings that are names of already-registered
Flag objects.
flag_values: A FlagValue object. This should almost never need
to be overridden.
Raises:
UnrecognizedFlagError: when we refer to a flag that was not
defined yet.
"""
module = _GetCallingModule()
for flag_name in flag_names:
if flag_name not in flag_values:
raise UnrecognizedFlagError(flag_name)
flag = flag_values.FlagDict()[flag_name]
flag_values._RegisterKeyFlagForModule(module, flag)
def DECLARE_key_flag(flag_name, flag_values=FLAGS):
"""Declares one flag as key to the current module.
Key flags are flags that are deemed really important for a module.
They are important when listing help messages; e.g., if the
--helpshort command-line flag is used, then only the key flags of the
main module are listed (instead of all flags, as in the case of
--help).
Sample usage:
flags.DECLARED_key_flag('flag_1')
Args:
flag_name: A string, the name of an already declared flag.
(Redeclaring flags as key, including flags implicitly key
because they were declared in this module, is a no-op.)
flag_values: A FlagValues object. This should almost never
need to be overridden.
"""
_InternalDeclareKeyFlags([flag_name], flag_values=flag_values)
def ADOPT_module_key_flags(module, flag_values=FLAGS):
"""Declares that all flags key to a module are key to the current module.
Args:
module: A module object.
flag_values: A FlagValues object. This should almost never need
to be overridden.
Raises:
FlagsError: When given an argument that is a module name (a
string), instead of a module object.
"""
# NOTE(salcianu): an even better test would be if not
# isinstance(module, types.ModuleType) but I didn't want to import
# types for such a tiny use.
if isinstance(module, str):
raise FlagsError('Received module name %s; expected a module object.'
% module)
_InternalDeclareKeyFlags(
[f.name for f in flag_values._GetKeyFlagsForModule(module.__name__)],
flag_values=flag_values)
#
# STRING FLAGS
#
def DEFINE_string(name, default, help, flag_values=FLAGS, **args):
"""Registers a flag whose value can be any string."""
parser = ArgumentParser()
serializer = ArgumentSerializer()
DEFINE(parser, name, default, help, flag_values, serializer, **args)
#
# BOOLEAN FLAGS
#
# and the special HELP flags.
class BooleanParser(ArgumentParser):
"""Parser of boolean values."""
def Convert(self, argument):
"""Converts the argument to a boolean; raise ValueError on errors."""
if type(argument) == str:
if argument.lower() in ['true', 't', '1']:
return True
elif argument.lower() in ['false', 'f', '0']:
return False
bool_argument = bool(argument)
if argument == bool_argument:
# The argument is a valid boolean (True, False, 0, or 1), and not just
# something that always converts to bool (list, string, int, etc.).
return bool_argument
raise ValueError('Non-boolean argument to boolean flag', argument)
def Parse(self, argument):
val = self.Convert(argument)
return val
def Type(self):
return 'bool'
class BooleanFlag(Flag):
"""Basic boolean flag.
Boolean flags do not take any arguments, and their value is either
True (1) or False (0). The false value is specified on the command
line by prepending the word 'no' to either the long or the short flag
name.
For example, if a Boolean flag was created whose long name was
'update' and whose short name was 'x', then this flag could be
explicitly unset through either --noupdate or --nox.
"""
def __init__(self, name, default, help, short_name=None, **args):
p = BooleanParser()
Flag.__init__(self, p, None, name, default, help, short_name, 1, **args)
if not self.help: self.help = "a boolean value"
def DEFINE_boolean(name, default, help, flag_values=FLAGS, **args):
"""Registers a boolean flag.
Such a boolean flag does not take an argument. If a user wants to
specify a false value explicitly, the long option beginning with 'no'
must be used: i.e. --noflag
This flag will have a value of None, True or False. None is possible
if default=None and the user does not specify the flag on the command
line.
"""
DEFINE_flag(BooleanFlag(name, default, help, **args), flag_values)
# Match C++ API to unconfuse C++ people.
DEFINE_bool = DEFINE_boolean
class HelpFlag(BooleanFlag):
"""
HelpFlag is a special boolean flag that prints usage information and
raises a SystemExit exception if it is ever found in the command
line arguments. Note this is called with allow_override=1, so other
apps can define their own --help flag, replacing this one, if they want.
"""
def __init__(self):
BooleanFlag.__init__(self, "help", 0, "show this help",
short_name="h", allow_override=1)
def Parse(self, arg):
if arg:
doc = sys.modules["__main__"].__doc__
flags = str(FLAGS)
print doc or ("\nUSAGE: echo SEQUENCE | %s [flags]\n or\n echo FASTA_FILE | %s [flags]\n" % (sys.argv[0], sys.argv[0]))
if flags:
print "flags:"
print flags
print ""
sys.exit(1)
class HelpXMLFlag(BooleanFlag):
"""Similar to HelpFlag, but generates output in XML format."""
def __init__(self):
BooleanFlag.__init__(self, 'helpxml', False,
'like --help, but generates XML output',
allow_override=1)
def Parse(self, arg):
if arg:
FLAGS.WriteHelpInXMLFormat(sys.stdout)
sys.exit(1)
class HelpshortFlag(BooleanFlag):
"""
HelpshortFlag is a special boolean flag that prints usage
information for the "main" module, and rasies a SystemExit exception
if it is ever found in the command line arguments. Note this is
called with allow_override=1, so other apps can define their own
--helpshort flag, replacing this one, if they want.
"""
def __init__(self):
BooleanFlag.__init__(self, "helpshort", 0,
"show usage only for this module", allow_override=1)
def Parse(self, arg):
if arg:
doc = sys.modules["__main__"].__doc__
flags = FLAGS.MainModuleHelp()
print doc or ("\nUSAGE: %s [flags]\n" % sys.argv[0])
if flags:
print "flags:"
print flags
sys.exit(1)
#
# FLOAT FLAGS
#
class FloatParser(ArgumentParser):
"""Parser of floating point values.
Parsed value may be bounded to a given upper and lower bound.
"""
number_article = "a"
number_name = "number"
syntactic_help = " ".join((number_article, number_name))
def __init__(self, lower_bound=None, upper_bound=None):
self.lower_bound = lower_bound
self.upper_bound = upper_bound
sh = self.syntactic_help
if lower_bound != None and upper_bound != None:
sh = ("%s in the range [%s, %s]" % (sh, lower_bound, upper_bound))
elif lower_bound == 1:
sh = "a positive %s" % self.number_name
elif upper_bound == -1:
sh = "a negative %s" % self.number_name
elif lower_bound == 0:
sh = "a non-negative %s" % self.number_name
elif upper_bound != None:
sh = "%s <= %s" % (self.number_name, upper_bound)
elif lower_bound != None:
sh = "%s >= %s" % (self.number_name, lower_bound)
self.syntactic_help = sh
def Convert(self, argument):
"""Converts argument to a float; raises ValueError on errors."""
return float(argument)
def Parse(self, argument):
val = self.Convert(argument)
if ((self.lower_bound != None and val < self.lower_bound) or
(self.upper_bound != None and val > self.upper_bound)):
raise ValueError("%s is not %s" % (val, self.syntactic_help))
return val
def Type(self):
return 'float'
def WriteCustomInfoInXMLFormat(self, outfile, indent):
if self.lower_bound is not None:
_WriteSimpleXMLElement(outfile, 'lower_bound', self.lower_bound, indent)
if self.upper_bound is not None:
_WriteSimpleXMLElement(outfile, 'upper_bound', self.upper_bound, indent)
# End of FloatParser
def DEFINE_float(name, default, help, lower_bound=None, upper_bound=None,
flag_values=FLAGS, **args):
"""Registers a flag whose value must be a float.
If lower_bound or upper_bound are set, then this flag must be
within the given range.
"""
parser = FloatParser(lower_bound, upper_bound)
serializer = ArgumentSerializer()
DEFINE(parser, name, default, help, flag_values, serializer, **args)
#
# INTEGER FLAGS
#
class IntegerParser(FloatParser):
"""Parser of an integer value.
Parsed value may be bounded to a given upper and lower bound.
"""
number_article = "an"
number_name = "integer"
syntactic_help = " ".join((number_article, number_name))
def Convert(self, argument):
__pychecker__ = 'no-returnvalues'
if type(argument) == str:
base = 10
if len(argument) > 2 and argument[0] == "0" and argument[1] == "x":
base = 16
try:
return int(argument, base)
# ValueError is thrown when argument is a string, and overflows an int.
except ValueError:
return long(argument, base)
else:
try:
return int(argument)
# OverflowError is thrown when argument is numeric, and overflows an int.
except OverflowError:
return long(argument)
def Type(self):
return 'int'
def DEFINE_integer(name, default, help, lower_bound=None, upper_bound=None,
flag_values=FLAGS, **args):
"""Registers a flag whose value must be an integer.
If lower_bound, or upper_bound are set, then this flag must be
within the given range.
"""
parser = IntegerParser(lower_bound, upper_bound)
serializer = ArgumentSerializer()
DEFINE(parser, name, default, help, flag_values, serializer, **args)
#
# ENUM FLAGS
#
class EnumParser(ArgumentParser):
"""Parser of a string enum value (a string value from a given set).
If enum_values (see below) is not specified, any string is allowed.
"""
def __init__(self, enum_values=None):
self.enum_values = enum_values
def Parse(self, argument):
if self.enum_values and argument not in self.enum_values:
raise ValueError("value should be one of <%s>" %
"|".join(self.enum_values))
return argument
def Type(self):
return 'string enum'
class EnumFlag(Flag):
"""Basic enum flag; its value can be any string from list of enum_values."""
def __init__(self, name, default, help, enum_values=None,
short_name=None, **args):
enum_values = enum_values or []
p = EnumParser(enum_values)
g = ArgumentSerializer()
Flag.__init__(self, p, g, name, default, help, short_name, **args)
if not self.help: self.help = "an enum string"
self.help = "<%s>: %s" % ("|".join(enum_values), self.help)
def _WriteCustomInfoInXMLFormat(self, outfile, indent):
for enum_value in self.parser.enum_values:
_WriteSimpleXMLElement(outfile, 'enum_value', enum_value, indent)
def DEFINE_enum(name, default, enum_values, help, flag_values=FLAGS,
**args):
"""Registers a flag whose value can be any string from enum_values."""
DEFINE_flag(EnumFlag(name, default, help, enum_values, ** args),
flag_values)
#
# LIST FLAGS
#
class BaseListParser(ArgumentParser):
"""Base class for a parser of lists of strings.
To extend, inherit from this class; from the subclass __init__, call
BaseListParser.__init__(self, token, name)
where token is a character used to tokenize, and name is a description
of the separator.
"""
def __init__(self, token=None, name=None):
assert name
self._token = token
self._name = name
self.syntactic_help = "a %s separated list" % self._name
def Parse(self, argument):
if argument == '':
return []
else:
return [s.strip() for s in argument.split(self._token)]
def Type(self):
return '%s separated list of strings' % self._name
class ListParser(BaseListParser):
"""Parser for a comma-separated list of strings."""
def __init__(self):
BaseListParser.__init__(self, ',', 'comma')
def WriteCustomInfoInXMLFormat(self, outfile, indent):
BaseListParser.WriteCustomInfoInXMLFormat(self, outfile, indent)
_WriteSimpleXMLElement(outfile, 'list_separator', repr(','), indent)
class WhitespaceSeparatedListParser(BaseListParser):
"""Parser for a whitespace-separated list of strings."""
def __init__(self):
BaseListParser.__init__(self, None, 'whitespace')
def WriteCustomInfoInXMLFormat(self, outfile, indent):
BaseListParser.WriteCustomInfoInXMLFormat(self, outfile, indent)
separators = list(string.whitespace)
separators.sort()
for ws_char in string.whitespace:
_WriteSimpleXMLElement(outfile, 'list_separator', repr(ws_char), indent)
def DEFINE_list(name, default, help, flag_values=FLAGS, **args):
"""Registers a flag whose value is a comma-separated list of strings."""
parser = ListParser()
serializer = ListSerializer(',')
DEFINE(parser, name, default, help, flag_values, serializer, **args)
def DEFINE_spaceseplist(name, default, help, flag_values=FLAGS, **args):
"""Registers a flag whose value is a whitespace-separated list of strings.
Any whitespace can be used as a separator.
"""
parser = WhitespaceSeparatedListParser()
serializer = ListSerializer(' ')
DEFINE(parser, name, default, help, flag_values, serializer, **args)
#
# MULTI FLAGS
#
class MultiFlag(Flag):
"""A flag that can appear multiple time on the command-line.
The value of such a flag is a list that contains the individual values
from all the appearances of that flag on the command-line.
See the __doc__ for Flag for most behavior of this class. Only
differences in behavior are described here:
* The default value may be either a single value or a list of values.
A single value is interpreted as the [value] singleton list.
* The value of the flag is always a list, even if the option was
only supplied once, and even if the default value is a single
value
"""
def __init__(self, *args, **kwargs):
Flag.__init__(self, *args, **kwargs)
self.help += ';\n repeat this option to specify a list of values'
def Parse(self, arguments):
"""Parses one or more arguments with the installed parser.
Args:
arguments: a single argument or a list of arguments (typically a
list of default values); a single argument is converted
internally into a list containing one item.
"""
if not isinstance(arguments, list):
# Default value may be a list of values. Most other arguments
# will not be, so convert them into a single-item list to make
# processing simpler below.
arguments = [arguments]
if self.present:
# keep a backup reference to list of previously supplied option values
values = self.value
else:
# "erase" the defaults with an empty list
values = []
for item in arguments:
# have Flag superclass parse argument, overwriting self.value reference
Flag.Parse(self, item) # also increments self.present
values.append(self.value)
# put list of option values back in the 'value' attribute
self.value = values
def Serialize(self):
if not self.serializer:
raise FlagsError("Serializer not present for flag %s" % self.name)
if self.value is None:
return ''
s = ''
multi_value = self.value
for self.value in multi_value:
if s: s += ' '
s += Flag.Serialize(self)
self.value = multi_value
return s
def Type(self):
return 'multi ' + self.parser.Type()
def DEFINE_multi(parser, serializer, name, default, help, flag_values=FLAGS,
**args):
"""Registers a generic MultiFlag that parses its args with a given parser.
Auxiliary function. Normal users should NOT use it directly.
Developers who need to create their own 'Parser' classes for options
which can appear multiple times can call this module function to
register their flags.
"""
DEFINE_flag(MultiFlag(parser, serializer, name, default, help, **args),
flag_values)
def DEFINE_multistring(name, default, help, flag_values=FLAGS, **args):
"""Registers a flag whose value can be a list of any strings.
Use the flag on the command line multiple times to place multiple
string values into the list. The 'default' may be a single string
(which will be converted into a single-element list) or a list of
strings.
"""
parser = ArgumentParser()
serializer = ArgumentSerializer()
DEFINE_multi(parser, serializer, name, default, help, flag_values, **args)
def DEFINE_multi_int(name, default, help, lower_bound=None, upper_bound=None,
flag_values=FLAGS, **args):
"""Registers a flag whose value can be a list of arbitrary integers.
Use the flag on the command line multiple times to place multiple
integer values into the list. The 'default' may be a single integer
(which will be converted into a single-element list) or a list of
integers.
"""
parser = IntegerParser(lower_bound, upper_bound)
serializer = ArgumentSerializer()
DEFINE_multi(parser, serializer, name, default, help, flag_values, **args)
# Now register the flags that we want to exist in all applications.
# These are all defined with allow_override=1, so user-apps can use
# these flagnames for their own purposes, if they want.
DEFINE_flag(HelpFlag())
DEFINE_flag(HelpshortFlag())
# lhuang
#DEFINE_flag(HelpXMLFlag())
# Define special flags here so that help may be generated for them.
_SPECIAL_FLAGS = FlagValues()
# lhuang
##DEFINE_string(
## 'flagfile', "",
## "Insert flag definitions from the given file into the command line.",
## _SPECIAL_FLAGS)
##DEFINE_string(
## 'undefok', "",
## "comma-separated list of flag names that it is okay to specify "
## "on the command line even if the program does not define a flag "
## "with that name. IMPORTANT: flags in this list that have "
## "arguments MUST use the --flag=value format.", _SPECIAL_FLAGS)gf
================================================
FILE: license.txt
================================================
The LinearDesign code is freely accessible to all interested parties.
It is free for academic, non-profit, and research use, and can be licensed for commercial use.
To use this software for the development of a commercial product, including but not limited to software, service, or pharmaceuticals, please contact the lead corresponding author.
Redistribution of the code with or without modification is not permitted without explicit written permission by the lead corresponding author.
================================================
FILE: lineardesign
================================================
#!/usr/bin/env python2
import gflags as flags
import subprocess
import sys
import os
FLAGS = flags.FLAGS
def setgflags():
flags.DEFINE_float('lambda', 0.0, "set lambda", short_name='l')
flags.DEFINE_boolean('verbose', False, "print out more details", short_name='v')
flags.DEFINE_string('codonusage', 'codon_usage_freq_table_human.csv', "import a Codon Usage Frequency Table", short_name='c')
argv = FLAGS(sys.argv)
def main():
lambda_ = str(FLAGS.l)
verbose_ = '1' if FLAGS.verbose else '0'
codon_usage = str(FLAGS.codonusage)
path = os.path.dirname(os.path.abspath(__file__))
cmd = ["%s/%s" % (path, ('bin/LinearDesign_2D')), lambda_, verbose_, codon_usage]
subprocess.call(cmd, stdin=sys.stdin)
if __name__ == '__main__':
setgflags()
main()
================================================
FILE: src/Utils/base.h
================================================
#ifndef base_h
#define base_h
#include <type_traits>
#include <utility>
#include <memory>
#include <string>
#include <vector>
#include <sstream>
#if defined(__GNUC__) || defined(__clang__)
#define LINEAR_DESIGN_DEPRECATED __attribute__((deprecated))
#elif defined(_MSC_VER)
#define LINEAR_DESIGN_DEPRECATED __declspec(deprecated)
#else
#pragma message("WARNING: function deprecated")
#define LINEAR_DESIGN_DEPRECATED
#endif
#if defined(__GNUC__) || defined(__clang__)
#define LINEAR_DESIGN_INLINE inline __attribute__((always_inline))
#else
#define LINEAR_DESIGN_INLINE inline
#endif
#define LINEAR_DESIGN_CACHELINE 64
template <bool B, typename T=void>
using enable_if_t = typename std::enable_if<B, T>::type;
template <typename T, enable_if_t<std::is_integral<T>::value, int> = 0>
std::ostream& operator<< (std::ostream& out, const std::pair<T, T>& rhs) {
out << "(" << rhs.first << ", " << rhs.second << ")";
return out;
}
template <typename T, enable_if_t<std::is_integral<T>::value, int> = 0>
std::ostream& operator<< (std::ostream& out, const std::vector<std::pair<T, T>>& rhs) {
out << "[";
for (size_t i = 0; i < rhs.size(); ++i) {
out << rhs[i];
if (i < rhs.size() - 1) out << ",";
}
out << "]";
return out;
}
namespace LinearDesign {
namespace util {
std::vector<std::string> split(const std::string &s, char delim) {
std::vector<std::string> result;
std::stringstream ss(s);
std::string item;
while (getline(ss, item, delim))
result.push_back(item);
return result;
}
template <typename T>
constexpr T value_min() {
static_assert(std::is_integral<T>::value ||
std::is_floating_point<T>::value, "Int or float required.");
return std::numeric_limits<T>::lowest();
}
template <typename T>
constexpr T value_max() {
static_assert(std::is_integral<T>::value ||
std::is_floating_point<T>::value, "Int or float required.");
return std::numeric_limits<T>::max();
}
} /* util */
// template <bool...> struct is_any;
// template <> struct is_any<> : std::false_type {};
// template <bool First, bool... Rest> struct is_any<First, Rest...> {
// constexpr static bool value = First || is_any<Rest...>::value;
// };
struct hash_pair_pair {
template <class T1, class T2, class T3>
size_t operator()(const std::pair<std::pair<T1, T2>, T3>& p) const {
auto hash1 = std::hash<T1>{}(p.first.first);
auto hash2 = std::hash<T2>{}(p.first.second);
auto hash3 = std::hash<T3>{}(p.second);
return hash1 ^ hash2 ^ hash3;
}
};
struct hash_pair {
template <class T1, class T2>
size_t operator()(const std::pair<T1, T2>& p) const {
auto hash1 = std::hash<T1>{}(p.first);
auto hash2 = std::hash<T2>{}(p.second);
return hash1 ^ hash2;
}
};
}
namespace Hash {
template <class T>
LINEAR_DESIGN_INLINE size_t hash_combine(size_t left_seed, const T& right) {
return left_seed ^ (std::hash<T>{}(right) << 1);
}
template <class Tuple, size_t Index = std::tuple_size<Tuple>::value - 1>
struct TupleHashImpl {
static size_t impl(size_t seed, const Tuple& tuple) {
size_t h = hash_combine(seed, std::get<Index>(tuple));
return TupleHashImpl<Tuple, Index-1>::impl(h, tuple);
}
};
template <class Tuple>
struct TupleHashImpl<Tuple, 0> {
static size_t impl(size_t seed, const Tuple& tuple) {
return hash_combine(seed, std::get<0>(tuple));
}
};
}
template <class... Ts>
struct std::hash<std::tuple<Ts...>> {
size_t operator()(const std::tuple<Ts...>& ts) const {
return Hash::TupleHashImpl<std::tuple<Ts...>>::impl(0, ts);
}
};
template <class T1, class T2>
struct std::hash<std::pair<T1, T2>> {
size_t operator()(const std::pair<T1, T2>& p) const {
size_t h = std::hash<T1>{}(p.first);
return Hash::hash_combine(h, p.second);
}
};
#endif
================================================
FILE: src/Utils/codon.h
================================================
#ifndef codon_h
#define codon_h
#include <exception>
#include <fstream>
#include <string>
#include <utility>
#include <map>
#include <vector>
#include <regex>
#include <cmath>
#include <typeinfo>
#include "base.h"
#include "constants.h"
namespace LinearDesign {
// trim from end (in place)
static inline void rtrim(std::string &s) {
s.erase(std::find_if(s.rbegin(), s.rend(), [](unsigned char ch) {
return !std::isspace(ch);
}).base(), s.end());
}
class Codon {
public:
Codon(const std::string& path) : codon_table_(), aa_table_() {
std::ifstream codon_file;
codon_file.open(path);
if (codon_file.is_open()) {
int index = 0;
for (std::string line; getline(codon_file, line);){
rtrim(line);
if(line.size() == 0 or line.empty())
continue;
if (index++ == 0)
continue;
const auto line_split = util::split(line, ',');
if(line_split.size() != 3){
std::cerr << "Wrong format of codon frequency file!" << std::endl;
exit(1);
}
const std::string codon = line_split[0];
const std::string aa = line_split[1];
const float fraction = std::stof(line_split[2]);
codon_table_[codon] = make_pair(aa, fraction);
aa_table_[aa].push_back(make_pair(codon, fraction));
if (!max_aa_table_.count(aa))
max_aa_table_[aa] = fraction;
else
max_aa_table_[aa] = fmax(max_aa_table_[aa], fraction);
}
codon_file.close();
if (codon_table_.size() != 64){
std::cerr << "Codon frequency file needs to contain 64 codons!" << std::endl;
exit(1);
}
} else {
std::cerr << "The input codon frequency file does not exist!" << std::endl;
exit(1);
}
}
float calc_cai(const std::string& rna_seq) const {
if (rna_seq.length() % 3)
throw std::runtime_error("invalid rna seq");
const int protein_length = static_cast<int>(rna_seq.length() / 3);
float cai = 0.0f;
for (int index = 3; index < rna_seq.length() + 1; index += 3) {
const std::string tri_letter = rna_seq.substr(index - 3, 3);
const auto f_ci_aa = codon_table_.at(tri_letter);
const auto f_c_max = max_aa_table_.at(f_ci_aa.first);
float w_i = f_ci_aa.second / f_c_max;
cai += log2f(w_i);
}
return exp2f(cai / protein_length);
}
std::string find_max_codon(const char aa,
const std::string& match) const {
auto candidate_condons = aa_table_.at(std::string(1, aa));
float max_score = 0;
std::string max_condon;
for (auto& candidate : candidate_condons) {
if (std::regex_match(candidate.first, std::regex(match)) &&
candidate.second > max_score) {
max_condon = candidate.first;
max_score = candidate.second;
}
}
if (max_condon.empty())
throw std::runtime_error("invald search");
// assert(codon_table_.at(max_condon).first == std::string(1, aa));
return max_condon;
}
std::string cvt_rna_seq_to_aa_seq(const std::string& rna_seq) const {
if (rna_seq.length() % 3)
throw std::runtime_error("invalid rna seq");
std::string aa_seq;
aa_seq.reserve(rna_seq.length());
for (int index = 3; index < rna_seq.length() + 1; index += 3) {
const std::string tri_letter = rna_seq.substr(index - 3, 3);
auto aa = codon_table_.at(tri_letter).first;
if (aa == "STOP") {
aa_seq.append("*");
return aa_seq;
}
aa_seq.append(codon_table_.at(tri_letter).first);
}
return aa_seq;
}
float get_weight(const std::string& aa_tri, const std::string& codon) const {
if (k_map_3_1.count(aa_tri)) {
auto codons = aa_table_.at(std::string(1, k_map_3_1[aa_tri]));
auto it = std::find_if(codons.begin(), codons.end(), [codon](const std::pair<std::string, float>& e){
// std::cout << typeid(e).name() << '\n';
return e.first == codon;
});
if (it == codons.end()) {
throw std::runtime_error("invalid codon");
}
return it->second;
} else if (three_prime_aa_table_.count(aa_tri)) {
return three_prime_aa_table_.at(aa_tri).second;
}
return 0.0f;
}
// private:
std::vector<std::string> aux_aa_;
std::map<std::string, std::pair<std::string, float>> three_prime_codon_table_;
std::map<std::string, std::pair<std::string, float>> three_prime_aa_table_;
std::map<std::string, float> max_aa_table_;
std::map<std::string, std::pair<std::string, float>> codon_table_;
std::map<std::string, std::vector<std::pair<std::string, float>>> aa_table_;
};
}
#endif
================================================
FILE: src/Utils/common.h
================================================
#ifndef common_h
#define common_h
#include <utility>
#include <functional>
#include <array>
#include <string>
#include <set>
#include <map>
#include <exception>
#include <list>
#include "base.h"
namespace LinearDesign {
using SizeType = size_t;
using ScoreType = int32_t;
using IndexType = int32_t; //if less than 10000, only int16_t is needed here
using NucType = int8_t;
using NumType = int32_t;
using NucPairType = int8_t;
using PairType = int8_t;
using FinalScoreType = double;
using NodeType = std::pair<IndexType, NumType>;
using NodeNucType = std::pair<NodeType, NucType>;
using NodeNucWType = std::tuple<NodeType, NucType, double>;
using PairType = int8_t;
enum class Manner : std::uint8_t {
NONE = 0, // 0: empty
H, // 1: hairpin candidate
HAIRPIN, // 2: hairpin
SINGLE, // 3: single
HELIX, // 4: helix
MULTI, // 5: multi = ..M2. [30 restriction on the left and jump on the right]
MULTI_eq_MULTI_plus_U, // 6: multi = multi + U
P_eq_MULTI, // 7: P = (multi)
M2_eq_M_plus_P, // 8: M2 = M + P
M_eq_M2, // 9: M = M2
M_eq_M_plus_U, // 10: M = M + U
M_eq_P, // 11: M = P
C_eq_C_plus_U, // 12: C = C + U
C_eq_C_plus_P, // 13: C = C + P
};
enum class Beam_type : std::uint8_t {
BEAM_C = 0,
BEAM_P,
BEAM_MULTI,
BEAM_M2,
BEAM_M1
};
template <typename ScoreType>
struct State {
ScoreType score = util::value_min<ScoreType>();
double cai_score = util::value_min<double>();
NodeType pre_node;
double pre_left_cai;
};
struct BacktraceResult {
std::string seq;
std::string structure;
};
template <typename ScoreType,
typename IndexType,
typename NodeType = std::pair<IndexType, IndexType>>
struct DecoderResult {
std::string sequence;
std::string structure;
ScoreType score;
ScoreType cai;
ScoreType old_cai;
IndexType num_states;
};
template <typename ScoreType,
typename IndexType,
typename NodeType = std::pair<IndexType, IndexType>>
struct ScoreInnerDate {
ScoreType newscore;
NodeType j_node;
NodeType i_node;
int nuc_pair;
};
struct NodeNucpair {
IndexType node_first;
NumType node_second;
NucPairType nucpair;
};
}
#endif /* common_h */
================================================
FILE: src/Utils/constants.h
================================================
#ifndef constants_h
#define constants_h
#include <map>
namespace LinearDesign {
constexpr uint8_t k_void_nuc = 127;
// static std::map<char, std::string> k_map_1_3 = {
// {'F',"Phe"},
// {'L',"Leu"},
// {'S',"Ser"},
// {'Y',"Tyr"},
// {'*',"STOP"},
// {'C',"Cys"},
// {'W',"Trp"},
// {'P',"Pro"},
// {'H',"His"},
// {'Q',"Gln"},
// {'R',"Arg"},
// {'I',"Ile"},
// {'M',"Met"},
// {'T',"Thr"},
// {'N',"Asn"},
// {'K',"Lys"},
// {'V',"Val"},
// {'D',"Asp"},
// {'E',"Glu"},
// {'G',"Gly"},
// {'A',"Ala"}
// };
static std::map<std::string, char> k_map_3_1 = {
{"Phe", 'F'},
{"Leu", 'L'},
{"Ser", 'S'},
{"Tyr", 'Y'},
{"STOP", '*'},
{"Cys", 'C'},
{"Trp", 'W'},
{"Pro", 'P'},
{"His", 'H'},
{"Gln", 'Q'},
{"Arg", 'R'},
{"Ile", 'I'},
{"Met", 'M'},
{"Thr", 'T'},
{"Asn", 'N'},
{"Lys", 'K'},
{"Val", 'V'},
{"Asp", 'D'},
{"Glu", 'E'},
{"Gly", 'G'},
{"Ala", 'A'}
};
}
#endif /* constants_h */
================================================
FILE: src/Utils/flat.h
================================================
#ifndef flat_h
#define flat_h
#include <type_traits>
#include <vector>
#include "base.h"
namespace detail {
template <class Key>
struct DefaultIndex {
inline size_t operator()(const Key key) const {
return static_cast<size_t>(key);
}
};
}
template <class Key, class T, class IndexFn = detail::DefaultIndex<Key>>
class Flat {
public:
using self_type = Flat;
using storage_type = std::vector<T>;
using key_type = Key;
using reference = T&;
using const_reference = const T&;
using iterator = typename storage_type::iterator;
LINEAR_DESIGN_INLINE iterator begin() {
return data_.begin();
}
LINEAR_DESIGN_INLINE iterator end() {
return data_.end();
}
LINEAR_DESIGN_INLINE bool empty() const {
return false;
}
LINEAR_DESIGN_INLINE void reserve(const size_t n) {
data_.reserve(n);
}
LINEAR_DESIGN_INLINE void resize(const size_t n) {
data_.resize(n);
}
template <enable_if_t<!std::is_integral<key_type>::value, int> = 0>
LINEAR_DESIGN_INLINE reference operator[](size_t index) {
return data_[index];
}
template <enable_if_t<!std::is_integral<key_type>::value, int> = 0>
LINEAR_DESIGN_INLINE const_reference operator[](size_t index) const {
return data_[index];
}
LINEAR_DESIGN_INLINE reference operator[](key_type key) {
return data_[index_(key)];
}
LINEAR_DESIGN_INLINE const_reference operator[](key_type key) const {
return data_[index_(key)];
}
LINEAR_DESIGN_INLINE size_t size() const {
return data_.size();
}
private:
IndexFn index_;
storage_type data_;
};
#endif /* flat_h */
================================================
FILE: src/Utils/network.h
================================================
#include <map>
#include <unordered_map>
#include <vector>
#include <fstream>
#include <string>
#include <sstream>
#include <algorithm>
#include <iterator>
#include <iostream>
#include <memory>
#include <string>
#include <limits>
#include <vector>
#include <unordered_map>
#include <algorithm>
#include <array>
#include "utility_v.h"
#include "common.h"
#include "codon.h"
using namespace std;
// #define is_verbose
namespace LinearDesign {
template <typename IndexType,
typename IndexWType = tuple<IndexType, double>,
typename NodeType = pair<IndexType, NumType>,
typename NodeNucWType = tuple<NodeType, NucType, double>>
class Lattice {
public:
unordered_map<IndexType, vector<NodeType>> nodes;
unordered_map<NodeType, vector<NodeNucWType>, hash_pair> left_edges;
unordered_map<NodeType, vector<NodeNucWType>, hash_pair> right_edges;
Lattice(): nodes(), left_edges(), right_edges() {};
void add_edge(NodeType n1, NodeType n2, NucType nuc, double weight = 0.0f){
right_edges[n1].push_back(make_tuple(n2, nuc, weight));
left_edges[n2].push_back(make_tuple(n1, nuc, weight));
}
void add_node(NodeType n1){
IndexType pos = get<0>(n1);
nodes[pos].push_back(n1);
}
};
template <typename IndexType,
typename IndexWType = pair<IndexType, double>,
typename NodeType = pair<IndexType, NumType>,
typename NodeNucWType = tuple<NodeType, NucType, double>>
class DFA {
public:
unordered_map<IndexType, vector<NodeType>> nodes;
unordered_map<NodeType, vector<NodeNucWType>, hash_pair> left_edges;
unordered_map<NodeType, vector<NodeNucWType>, hash_pair> right_edges;
unordered_map<NodeType, unordered_map<NodeType, vector<IndexWType>, hash_pair>, hash_pair> auxiliary_left_edges;
unordered_map<NodeType, unordered_map<NodeType, vector<IndexWType>, hash_pair>, hash_pair> auxiliary_right_edges;
unordered_map<NodeType, unordered_map<IndexType, double>, hash_pair> node_rightedge_weights;
DFA(): nodes(), left_edges(), right_edges(), auxiliary_left_edges(), auxiliary_right_edges() {};
void add_edge(NodeType n1, NodeType n2, IndexType nuc, double weight = 0.0f){
right_edges[n1].push_back(make_tuple(n2, nuc, weight));
left_edges[n2].push_back(make_tuple(n1, nuc, weight));
auxiliary_right_edges[n1][n2].push_back(make_pair(nuc, weight));
auxiliary_left_edges[n2][n1].push_back(make_pair(nuc, weight));
node_rightedge_weights[n1][nuc] = weight;
}
void add_node(NodeType n1){
IndexType pos = get<0>(n1);
nodes[pos].push_back(n1);
}
};
template <typename IndexType,
typename NodeType = pair<IndexType, NumType>,
typename LatticeType = Lattice<IndexType>>
unordered_map<string, LatticeType> read_wheel(string const &filename) {
unordered_map<string, LatticeType> aa_graphs;
ifstream inFile;
inFile.open(filename);
if (!inFile) {
printf("Unable to open coding_wheel file\n");
exit(1); // call system to stop
}
vector<string> stuff;
vector<string> option_splited;
string aa;
IndexType i;
for (string line; getline(inFile, line);) {
stuff = util::split(line, '\t');
aa = stuff[0];
LatticeType graph = LatticeType();
graph.add_node(make_pair(0,0)); // always initialize with node (0,0)
char last_first = 0;
vector<string>::iterator iter = stuff.begin();
++iter; // position 0 is aa name
i = 0;
while(iter != stuff.end()){
string option = *iter;
option_splited = util::split(option, ' ');
char first = option_splited[0][0];
char second = option_splited[1][0];
string thirds = option_splited[2];
NodeType n2 = make_pair(2, i);
graph.add_node(n2);
NodeType n1;
if (first != last_first) {
n1 = make_pair(1, i);
graph.add_node(n1);
graph.add_edge(make_pair(0, 0), n1, GET_ACGU_NUC(first));
}
else {
n1 = make_pair(1, i-1);
}
last_first = first;
graph.add_edge(n1, n2, GET_ACGU_NUC(second));
for (auto& third : thirds) {
graph.add_edge(n2, make_pair(0,0), GET_ACGU_NUC(third));
}
i++; iter++;
}
aa_graphs[aa] = graph;
#ifdef is_verbose
printf("-----------------Lattice------------------------\n");
for(IndexType pos = 0; pos <= 2; pos++){
for(auto &node : graph.nodes[pos]){
IndexType p = get<0>(node);
IndexType num = get<1>(node);
printf("node, (%d, %d)\n", p, num);
for(auto &item : graph.right_edges[node]){
NodeType n2 = get<0>(item);
IndexType p2 = get<0>(n2); IndexType num2 = get<1>(n2);
IndexType nuc = get<1>(item);
double weight = get<2>(item);
printf(" (%d, %d) -(%d,%lf)-> (%d, %d)\n", p, num, nuc, weight, p2, num2);
}
for(auto &item : graph.left_edges[node]){
NodeType n1 = get<0>(item);
IndexType p1 = get<0>(n1); IndexType num1 = get<1>(n1);
IndexType nuc = get<1>(item);
double weight = get<2>(item);
printf(" (%d, %d) <-(%d,%lf)- (%d, %d)\n", p1, num1, nuc, weight, p, num);
}
}
}
#endif
}
inFile.close();
return aa_graphs;
}
template <typename IndexType,
typename NodeType = pair<IndexType, NumType>,
typename LatticeType = Lattice<IndexType>,
typename NucType = IndexType,
typename NodeNucNodeType = std::tuple<NodeType, NucType, NodeType>>
unordered_map<string, LatticeType> read_wheel_with_weights(const std::string& filename,
std::unordered_map<std::string, std::unordered_map<NodeType, double, hash_pair>>& nodes_with_best_weight,
std::unordered_map<std::string, std::unordered_map<NodeNucNodeType, double, std::hash<NodeNucNodeType>>>& edges_with_best_weight,
const Codon& codon) {
unordered_map<string, LatticeType> aa_graphs;
ifstream inFile;
inFile.open(filename);
if (!inFile)
throw std::runtime_error("Unable to open coding_wheel file\n");
vector<string> stuff;
vector<string> option_splited;
string aa;
IndexType i;
for (string line; getline(inFile, line);) {
stuff = util::split(line, '\t');
aa = stuff[0];
LatticeType graph = LatticeType();
graph.add_node(make_pair(0,0)); // always initialize with node (0,0)
char last_first = 0;
vector<string>::iterator iter = stuff.begin();
++iter; // position 0 is aa name
i = 0;
while(iter != stuff.end()){
string option = *iter;
option_splited = util::split(option, ' ');
char first = option_splited[0][0];
char second = option_splited[1][0];
string thirds = option_splited[2];
NodeType n2 = make_pair(2, i);
graph.add_node(n2);
NodeType n1;
if (first != last_first) {
n1 = make_pair(1, i);
graph.add_node(n1);
auto first_num = GET_ACGU_NUC(first);
double weight = 0.0f;
if (nodes_with_best_weight[aa].count(make_pair(0, 0))) {
weight = edges_with_best_weight[aa][make_tuple(make_pair(0, 0), first_num, n1)] / nodes_with_best_weight[aa][make_pair(0, 0)];
}
graph.add_edge(make_pair(0, 0), n1, first_num, weight);
}
else {
n1 = make_pair(1, i-1);
}
last_first = first;
auto second_num = GET_ACGU_NUC(second);
double weight = 0.0f;
if (nodes_with_best_weight[aa].count(n1)) {
weight = edges_with_best_weight[aa][make_tuple(n1, second_num, n2)] / nodes_with_best_weight[aa][n1];
}
graph.add_edge(n1, n2, second_num, weight);
for (auto& third : thirds) {
std::string three_nums = std::string(1, first) + std::string(1, second) + std::string(1, third);
double weight = 0.0f;
if (nodes_with_best_weight[aa].count(n2)) {
weight = codon.get_weight(aa, three_nums) / nodes_with_best_weight[aa][n2];
} else {
weight = codon.get_weight(aa, three_nums);
}
graph.add_edge(n2, make_pair(0,0), GET_ACGU_NUC(third), weight);
}
i++; iter++;
}
aa_graphs[aa] = graph;
}
inFile.close();
return aa_graphs;
}
template <typename IndexType,
typename NodeType = pair<IndexType, NumType>,
typename LatticeType = Lattice<IndexType>,
typename NucType = IndexType,
typename NodeNucNodeType = std::tuple<NodeType, NucType, NodeType>>
unordered_map<string, LatticeType> read_wheel_with_weights_log(const std::string& filename,
std::unordered_map<std::string, std::unordered_map<NodeType, double, hash_pair>>& nodes_with_best_weight,
std::unordered_map<std::string, std::unordered_map<NodeNucNodeType, double, std::hash<NodeNucNodeType>>>& edges_with_best_weight,
const Codon& codon, double lambda_) {
unordered_map<string, LatticeType> aa_graphs;
ifstream inFile;
inFile.open(filename);
if (!inFile)
throw std::runtime_error("Unable to open coding_wheel file\n");
vector<string> stuff;
vector<string> option_splited;
string aa;
IndexType i;
for (string line; getline(inFile, line);) {
stuff = util::split(line, '\t');
aa = stuff[0];
LatticeType graph = LatticeType();
graph.add_node(make_pair(0,0)); // always initialize with node (0,0)
char last_first = 0;
vector<string>::iterator iter = stuff.begin();
++iter; // position 0 is aa name
i = 0;
while(iter != stuff.end()){
string option = *iter;
option_splited = util::split(option, ' ');
char first = option_splited[0][0];
char second = option_splited[1][0];
string thirds = option_splited[2];
NodeType n2 = make_pair(2, i);
graph.add_node(n2);
NodeType n1;
if (first != last_first) {
n1 = make_pair(1, i);
graph.add_node(n1);
auto first_num = GET_ACGU_NUC(first);
double weight = 1.0f;
if (nodes_with_best_weight[aa].count(make_pair(0, 0))) {
weight = lambda_ * log(edges_with_best_weight[aa][make_tuple(make_pair(0, 0), first_num, n1)] / nodes_with_best_weight[aa][make_pair(0, 0)]);
}
graph.add_edge(make_pair(0, 0), n1, first_num, weight);
}
else {
n1 = make_pair(1, i-1);
}
last_first = first;
auto second_num = GET_ACGU_NUC(second);
double weight = 1.0f;
if (nodes_with_best_weight[aa].count(n1)) {
weight = lambda_ * log(edges_with_best_weight[aa][make_tuple(n1, second_num, n2)] / nodes_with_best_weight[aa][n1]);
}
graph.add_edge(n1, n2, second_num, weight);
for (auto& third : thirds) {
std::string three_nums = std::string(1, first) + std::string(1, second) + std::string(1, third);
double weight = 1.0f;
if (nodes_with_best_weight[aa].count(n2)) {
weight = lambda_ * log(codon.get_weight(aa, three_nums) / nodes_with_best_weight[aa][n2]);
} else {
weight = lambda_ * log(codon.get_weight(aa, three_nums));
}
graph.add_edge(n2, make_pair(0,0), GET_ACGU_NUC(third), weight);
}
i++; iter++;
}
aa_graphs[aa] = graph;
}
inFile.close();
return aa_graphs;
}
template <typename IndexType,
typename NucType = IndexType,
typename NodeType = pair<IndexType, NumType>,
typename NodeNucNodeType = std::tuple<NodeType, NucType, NodeType>,
typename WeightType = double,
typename LatticeType = Lattice<IndexType>>
void prepare_codon_unit_lattice(const std::string& wheel_path, const Codon& codon,
std::unordered_map<string, LatticeType>& aa_graphs_with_ln_weights_ret,
std::unordered_map<std::string, std::unordered_map<std::tuple<NodeType, NodeType>, std::tuple<double, NucType, NucType>, std::hash<std::tuple<NodeType, NodeType>>>>&
best_path_in_one_codon_unit_ret,
std::unordered_map<std::string, std::string>& aa_best_path_in_a_whole_codon_ret, double lambda_) {
std::unordered_map<std::string, std::unordered_map<NodeType, WeightType, hash_pair>> nodes_with_best_weight;
std::unordered_map<std::string, std::unordered_map<NodeNucNodeType, WeightType, std::hash<NodeNucNodeType>>> edges_with_best_weight;
unordered_map<string, LatticeType> aa_graphs_with_ln_weights;
unordered_map<string, LatticeType> aa_graphs_with_weights = read_wheel_with_weights<IndexType>(wheel_path, nodes_with_best_weight, edges_with_best_weight, codon);
for (auto& aa_aa_elem : aa_graphs_with_weights) {
auto& aa = aa_aa_elem.first;
auto& aa_elem = aa_aa_elem.second;
for (auto& node_at_2 : aa_elem.nodes[2]) {
for (auto& node_at_3_nuc_weight : aa_elem.right_edges[node_at_2]) {
auto node_at_3 = std::get<0>(node_at_3_nuc_weight);
auto nuc = std::get<1>(node_at_3_nuc_weight);
auto weight = std::get<2>(node_at_3_nuc_weight);
nodes_with_best_weight[aa][node_at_2] = max(nodes_with_best_weight[aa][node_at_2], weight);
edges_with_best_weight[aa][make_tuple(node_at_2,nuc,node_at_3)] = weight;
}
}
for (auto& node_at_1 : aa_elem.nodes[1]) {
for (auto& node_at_2_nuc_weight : aa_elem.right_edges[node_at_1]) {
auto node_at_2 = std::get<0>(node_at_2_nuc_weight);
auto nuc = std::get<1>(node_at_2_nuc_weight);
nodes_with_best_weight[aa][node_at_1] = max(nodes_with_best_weight[aa][node_at_1], nodes_with_best_weight[aa][node_at_2]);
edges_with_best_weight[aa][make_tuple(node_at_1,nuc,node_at_2)] = nodes_with_best_weight[aa][node_at_2];
}
}
for (auto& node_at_0 : aa_elem.nodes[0]) {
for (auto& node_at_1_nuc_weight : aa_elem.right_edges[node_at_0]) {
auto node_at_1 = std::get<0>(node_at_1_nuc_weight);
auto nuc = std::get<1>(node_at_1_nuc_weight);
nodes_with_best_weight[aa][node_at_0] = max(nodes_with_best_weight[aa][node_at_0], nodes_with_best_weight[aa][node_at_1]);
edges_with_best_weight[aa][make_tuple(node_at_0,nuc,node_at_1)] = nodes_with_best_weight[aa][node_at_1];
}
}
}
aa_graphs_with_ln_weights = read_wheel_with_weights_log<IndexType>(wheel_path, nodes_with_best_weight, edges_with_best_weight, codon, lambda_);
std::unordered_map<std::string,
std::unordered_map<std::tuple<NodeType, NodeType>,
std::tuple<double, NucType, NucType>,
std::hash<std::tuple<NodeType, NodeType>>>>
best_path_in_one_codon_unit;
for (auto& aa_graph : aa_graphs_with_ln_weights) {
auto& aa = aa_graph.first;
auto& graph = aa_graph.second;
for (auto& node_0 : graph.nodes[0]) {
for (auto& node_1_nuc_log_w : graph.right_edges[node_0]) {
auto node_1 = std::get<0>(node_1_nuc_log_w);
auto nuc = std::get<1>(node_1_nuc_log_w);
auto log_weight = std::get<2>(node_1_nuc_log_w);
if (!best_path_in_one_codon_unit[aa].count(make_tuple(node_0,node_1)))
best_path_in_one_codon_unit[aa][make_tuple(node_0,node_1)] = make_tuple(util::value_min<double>(),k_void_nuc,k_void_nuc);
double current_log_weight = std::get<0>(best_path_in_one_codon_unit[aa][make_tuple(node_0,node_1)]);
if (current_log_weight < log_weight) {
best_path_in_one_codon_unit[aa][make_tuple(node_0,node_1)] = make_tuple(log_weight,nuc,k_void_nuc);
}
}
}
for (auto& node_1 : graph.nodes[1]) {
for (auto& node_2_nuc_log_w : graph.right_edges[node_1]) {
auto node_2 = std::get<0>(node_2_nuc_log_w);
auto nuc = std::get<1>(node_2_nuc_log_w);
auto log_weight = std::get<2>(node_2_nuc_log_w);
if (!best_path_in_one_codon_unit[aa].count(make_tuple(node_1,node_2)))
best_path_in_one_codon_unit[aa][make_tuple(node_1,node_2)] = make_tuple(util::value_min<double>(),k_void_nuc,k_void_nuc);
double current_log_weight = std::get<0>(best_path_in_one_codon_unit[aa][make_tuple(node_1,node_2)]);
if (current_log_weight < log_weight) {
best_path_in_one_codon_unit[aa][make_tuple(node_1,node_2)] = make_tuple(log_weight,nuc,k_void_nuc);
}
auto temp = best_path_in_one_codon_unit[aa][make_tuple(node_1,node_2)];
}
}
for (auto& node_2 : graph.nodes[2]) {
for (auto& node_3_nuc_log_w : graph.right_edges[node_2]) {
auto node_3 = std::get<0>(node_3_nuc_log_w);
auto nuc = std::get<1>(node_3_nuc_log_w);
auto log_weight = std::get<2>(node_3_nuc_log_w);
if (!best_path_in_one_codon_unit[aa].count(make_tuple(node_2,node_3)))
best_path_in_one_codon_unit[aa][make_tuple(node_2,node_3)] = make_tuple(util::value_min<double>(),k_void_nuc,k_void_nuc);
double current_log_weight = std::get<0>(best_path_in_one_codon_unit[aa][make_tuple(node_2,node_3)]);
if (current_log_weight < log_weight) {
best_path_in_one_codon_unit[aa][make_tuple(node_2,node_3)] = make_tuple(log_weight,nuc,k_void_nuc);
}
}
}
for (auto& node_0 : graph.nodes[0]) {
for (auto& node_1_nuc_0_log_weight_0 : graph.right_edges[node_0]) {
auto& node_1 = std::get<0>(node_1_nuc_0_log_weight_0);
auto& nuc_0 = std::get<1>(node_1_nuc_0_log_weight_0);
auto log_weight_0 = std::get<2>(node_1_nuc_0_log_weight_0);
for (auto& node_2_nuc_1_log_weight_1 : graph.right_edges[node_1]) {
auto& node_2 = std::get<0>(node_2_nuc_1_log_weight_1);
auto& nuc_1 = std::get<1>(node_2_nuc_1_log_weight_1);
auto log_weight_1 = std::get<2>(node_2_nuc_1_log_weight_1);
if (!best_path_in_one_codon_unit[aa].count(make_tuple(node_0,node_2)))
best_path_in_one_codon_unit[aa][make_tuple(node_0,node_2)] = make_tuple(util::value_min<double>(),k_void_nuc,k_void_nuc);
if (std::get<0>(best_path_in_one_codon_unit[aa][make_tuple(node_0,node_2)]) < log_weight_0 + log_weight_1)
best_path_in_one_codon_unit[aa][make_tuple(node_0,node_2)] = make_tuple(log_weight_0 + log_weight_1, nuc_0, nuc_1);
}
}
}
for (auto& node_1 : graph.nodes[1]) {
for (auto& node_2_nuc_1_log_weight_1 : graph.right_edges[node_1]) {
auto& node_2 = std::get<0>(node_2_nuc_1_log_weight_1);
auto& nuc_1 = std::get<1>(node_2_nuc_1_log_weight_1);
auto log_weight_1 = std::get<2>(node_2_nuc_1_log_weight_1);
for (auto& node_3_nuc_2_log_weight_2 : graph.right_edges[node_2]) {
auto& node_3 = std::get<0>(node_3_nuc_2_log_weight_2);
auto& nuc_2 = std::get<1>(node_3_nuc_2_log_weight_2);
auto log_weight_2 = std::get<2>(node_3_nuc_2_log_weight_2);
if (!best_path_in_one_codon_unit[aa].count(make_tuple(node_1,node_3)))
best_path_in_one_codon_unit[aa][make_tuple(node_1,node_3)] = make_tuple(util::value_min<double>(),k_void_nuc,k_void_nuc);
if (std::get<0>(best_path_in_one_codon_unit[aa][make_tuple(node_1,node_3)]) < log_weight_1 + log_weight_2)
best_path_in_one_codon_unit[aa][make_tuple(node_1,node_3)] = make_tuple(log_weight_1 + log_weight_2, nuc_1, nuc_2);
}
}
}
}
std::unordered_map<std::string, double> max_path;
std::unordered_map<std::string, std::string> aa_best_path_in_a_whole_codon;
for (auto& aa_path_weight : codon.aa_table_) {
auto& aa = aa_path_weight.first; // char
for (auto& path_weight : aa_path_weight.second) {
if (max_path[aa] < path_weight.second) {
max_path[aa] = path_weight.second;
aa_best_path_in_a_whole_codon[aa] = path_weight.first;
}
}
}
aa_graphs_with_ln_weights_ret = aa_graphs_with_ln_weights;
best_path_in_one_codon_unit_ret = best_path_in_one_codon_unit;
aa_best_path_in_a_whole_codon_ret = aa_best_path_in_a_whole_codon;
}
template <typename IndexType,
typename NodeType = pair<IndexType, NumType>,
typename LatticeType = Lattice<IndexType>,
typename DFAType = DFA<IndexType>>
DFAType get_dfa(unordered_map<string, LatticeType> aa_graphs, vector<string> aa_seq) {
DFAType dfa = DFAType();
NodeType newnode = make_pair(3 * static_cast<IndexType>(aa_seq.size()), 0);
dfa.add_node(newnode);
IndexType i = 0;
IndexType i3;
string aa;
LatticeType graph;
for(auto& item : aa_seq) {
i3 = i * 3;
aa = aa_seq[i];
graph = aa_graphs[aa];
for (IndexType pos = 0; pos <= 2; pos++) {
for(auto& node : graph.nodes[pos]) {
IndexType num = get<1>(node);
newnode = make_pair(i3 + pos, num);
dfa.add_node(newnode);
for (auto& edge : graph.right_edges[node]) {
NodeType n2 = get<0>(edge);
IndexType nuc = get<1>(edge);
num = get<1>(n2);
NodeType newn2 = make_pair(i3 + pos + 1, num);
dfa.add_edge(newnode, newn2, nuc, get<2>(edge));
}
}
}
i++;
}
#ifdef is_verbose
printf("-----------------DFA------------------------\n");
for(IndexType pos = 0; pos < 3 * static_cast<IndexType>(aa_seq.size()) + 1; pos++){
for(auto& node : dfa.nodes[pos]) {
IndexType p = get<0>(node);
IndexType num = get<1>(node);
printf("node, (%d, %d)\n", p, num);
for(auto &n2 : dfa.auxiliary_right_edges[node]){
IndexType p2 = get<0>(n2.first);
IndexType num2 = get<1>(n2.first);
for(auto nuc : n2.second){
printf(" (%d, %d) -(%d,%lf)-> (%d, %d)\n", p, num, get<0>(nuc),get<1>(nuc), p2, num2);
}
}
for(auto &n1 : dfa.auxiliary_left_edges[node]){
IndexType p1 = get<0>(n1.first); IndexType num1 = get<1>(n1.first);
for(auto nuc : n1.second){
printf(" (%d, %d) <-(%d,%lf)- (%d, %d)\n", p1, num1, get<0>(nuc),get<1>(nuc), p, num);
}
}
}
}
#endif
return dfa;
}
}
================================================
FILE: src/Utils/reader.h
================================================
#ifndef fasta_h
#define fasta_h
#include <exception>
#include <map>
#include <fstream>
#include <string>
#include "base.h"
namespace LinearDesign {
struct Reader {
static bool cvt_to_seq(const string& from, string& to) {
return false;
}
};
struct Fasta : public Reader {
static map<char, string> map_fasta;
static bool cvt_to_seq(const string& fasta, string& nucs) {
nucs.reserve(4 * fasta.length());
for(auto aa : fasta) {
if (map_fasta.count(aa)) {
nucs.append(map_fasta[aa] + " ");
} else {
cerr << "invalid protein sequence!\n" << endl;
return false;
}
}
nucs.pop_back();
return true;
}
};
map<char, string> Fasta::map_fasta = {
{'F',"Phe"},
{'L',"Leu"},
{'S',"Ser"},
{'Y',"Tyr"},
{'*',"STOP"},
{'C',"Cys"},
{'W',"Trp"},
{'P',"Pro"},
{'H',"His"},
{'Q',"Gln"},
{'R',"Arg"},
{'I',"Ile"},
{'M',"Met"},
{'T',"Thr"},
{'N',"Asn"},
{'K',"Lys"},
{'V',"Val"},
{'D',"Asp"},
{'E',"Glu"},
{'G',"Gly"},
{'A',"Ala"}
};
template <class T>
struct ReaderTraits {
static bool cvt_to_seq(const string& from, string& to) {
return T::cvt_to_seq(from, to);
}
};
}
#endif /* fasta_h */
================================================
FILE: src/Utils/utility_v.h
================================================
#ifndef FASTCKY_UTILITY_V_H
#define FASTCKY_UTILITY_V_H
#include <string>
#include <vector>
#include <cmath>
#include <assert.h>
#define NTP(x,y) (x==1? (y==4?5:0) : (x==2? (y==3?1:0) : (x==3 ? (y==2?2:(y==4?3:0)) : (x==4 ? (y==3?4:(y==1?6:0)) : 0))))
#define PTLN(x) (x==1? 2:((x==2 || x==3)? 3:(x==5)? 1:4))
#define PTRN(x) (x==2? 2:((x==1 || x==4)? 3:(x==6)? 1:4))
#define NOTON 5 // NUM_OF_TYPE_OF_NUCS
#define NOTOND 25
#define NOTONT 125
#define EXPLICIT_MAX_LEN 4
#define SINGLE_MIN_LEN 0
#define SINGLE_MAX_LEN 20 // NOTE: *must* <= sizeof(char), otherwise modify State::TraceInfo accordingly
#define HAIRPIN_MAX_LEN 30
#define BULGE_MAX_LEN SINGLE_MAX_LEN
#define INTERNAL_MAX_LEN SINGLE_MAX_LEN
#define SYMMETRIC_MAX_LEN 15
#define ASYMMETRY_MAX_LEN 28
#define SPECIAL_HAIRPIN_SCORE_BASELINE -10000
extern bool _allowed_pairs[NOTON][NOTON];
#define MAXLOOP 30
#define GET_ACGU(x) ((x==1? 'A' : (x==2? 'C' : (x==3? 'G' : (x==4?'U': 'X')))))
#define GET_ACGU_NUC(x) ((x=='A'? 1 : (x=='C'? 2 : (x=='G'? 3 : (x=='U'?4: 0)))))
#define HAIRPINTYPE(x) ((x==5?0 : (x==6?1 : (x==8?2 : 3))))
extern int func1(std::string& a, int8_t b);
extern void func2(std::string& a, int b, std::vector<int>& c, std::vector<int>& d, std::vector<int>& e);
extern int func3(int a, int b, int c, int d, int e);
extern int func4(int a, int b, int c, int d, int e, int f, int g);
extern int func5(int a, int b, int c);
extern int func6(int a, int b, int c, int d, int e, int f, int g, int h);
extern int func7(int a, int b, int c, int d, int e, int h, int i);
extern int func8(int a, int b);
extern void func9(int a, int b);
extern int func10(int a, int b, int c);
extern int func11(int a, int b, int c, int d, int e, int f, int g, int h);
extern int func12(int a, int b, int c, int d, int e, int f, int g = -1);
extern int func13(int a, int b);
extern int func14(int a, int b, int c, int d, int e, int f, int g, int h, int i, int j, int k, int l);
extern int func15(int a, int b, int c, int d, int e, int f, int g);
#endif
================================================
FILE: src/backtrace_iter.cc
================================================
#include "beam_cky_parser.h"
using namespace std;
#define tetra_hex_tri -1
namespace LinearDesign {
template <typename ScoreType, typename IndexType, typename NodeType>
BacktraceResult BeamCKYParser<ScoreType, IndexType, NodeType>::backtrace(DFA_t& dfa, const State_t& state, NodeType end_node){
char sequence[seq_length+1];
memset(sequence, '.', seq_length);
sequence[seq_length] = 0;
char structure[seq_length+1];
memset(structure, '.', seq_length);
structure[seq_length] = 0;
bool no_backpointer;
stack<tuple<NodeType, NodeType, State_t, Beam_type, PairType>> stk;
NodeType start_node = make_pair(0, 0);
stk.push(make_tuple(start_node, end_node, state, Beam_type::BEAM_C, -1));
double epsilon = 1e-8;
while(!stk.empty()) {
tuple<NodeType, NodeType, State_t, Beam_type, PairType> top = stk.top();
NodeType i_node = get<0>(top), j_node = get<1>(top);
State_t& state = get<2>(top);
Beam_type beam_type = get<3>(top);
PairType curr_pair_nuc = get<4>(top);
stk.pop();
IndexType i, j, p, q, hairpin_length;
j = j_node.first;
NucType nuci, nucj, nuci1, nucj_1;
no_backpointer = true;
int left_start, left_end, right_start, right_end;
switch (beam_type) {
case Beam_type::BEAM_C:
if (j <= 0) continue;
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
auto j_1_node = std::get<0>(j_1_node_nucj_1);
auto& c_state = bestC[j_1_node];
auto weight_nucj_1 = std::get<2>(j_1_node_nucj_1);
auto cai_score = c_state.cai_score + weight_nucj_1;
if (state.score == c_state.score && abs(state.cai_score - cai_score) < epsilon){
NucType nucj_1 = std::get<1>(j_1_node_nucj_1);
stk.push(make_tuple(i_node, j_1_node, c_state, Beam_type::BEAM_C, curr_pair_nuc));
sequence[j-1] = GET_ACGU(nucj_1);
no_backpointer = false;
break;
}
}
// C = C + P
if(no_backpointer) {
for (size_t c_node_nucpair_ = 0; c_node_nucpair_ < 16 * seq_length; ++c_node_nucpair_){
auto& p_state = bestP[j_node][c_node_nucpair_];
if (p_state.score == util::value_min<ScoreType>()) continue;
auto c_node_nucpair = reverse_index(c_node_nucpair_);
auto c = c_node_nucpair.node_first;
auto c_num = c_node_nucpair.node_second;
auto pair_nuc = c_node_nucpair.nucpair;
auto c_node = make_pair(c, c_num);
auto nucc = PTLN(pair_nuc);
auto nucj_1 = PTRN(pair_nuc);
auto newscore = - func3(c, j-1, nucc, nucj_1, seq_length) + p_state.score;
if (c > 0){
auto& c_state = bestC[c_node];
auto cai_score = c_state.cai_score + p_state.cai_score;
if (state.score == c_state.score + newscore && abs(state.cai_score - cai_score) < epsilon){
stk.push(make_tuple(i_node, c_node, c_state, Beam_type::BEAM_C, curr_pair_nuc));
stk.push(make_tuple(c_node, j_node, p_state, Beam_type::BEAM_P, pair_nuc));
no_backpointer = false;
break;
}
} else{
if (state.score == newscore && abs(state.cai_score - p_state.cai_score) < epsilon){
stk.push(make_tuple(c_node, j_node, p_state, Beam_type::BEAM_P, pair_nuc));
no_backpointer = false;
break;
}
}
}
if (!no_backpointer) break;
}
assert(no_backpointer == false); // something wrong if no path matches
break;
case Beam_type::BEAM_P:
i = i_node.first;
j = j_node.first;
nuci = PTLN(curr_pair_nuc);
nucj_1 = PTRN(curr_pair_nuc);
hairpin_length = j - i;
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
NucType new_nucj_1 = std::get<1>(j_1_node_nucj_1);
if (new_nucj_1 != nucj_1) continue;
auto j_1_node = std::get<0>(j_1_node_nucj_1);
auto weight_nucj_1 = std::get<2>(j_1_node_nucj_1);
#ifdef SPECIAL_HP
if (hairpin_length == 5 or hairpin_length == 6 or hairpin_length == 8){
for(auto & seq_score_weight : hairpin_seq_score_cai[i_node][j_1_node][NTP(nuci, nucj_1)]){
auto seq = get<0>(seq_score_weight);
auto pre_cal_score = get<1>(seq_score_weight);
auto pre_cal_cai_score = get<2>(seq_score_weight);
if (state.score == pre_cal_score && abs(state.cai_score - pre_cal_cai_score) < epsilon){
for(int c=0; c<seq.size(); c++)
sequence[i+c] = seq[c];
structure[i] = '(';
structure[j-1] = ')';
no_backpointer = false;
break;
}
}if (!no_backpointer) break;
}if (!no_backpointer) break;
#endif
for (auto& i1_node_nuci : dfa.right_edges[i_node]){
NucType new_nuci = std::get<1>(i1_node_nuci);
if (new_nuci != nuci) continue;
auto i1_node = std::get<0>(i1_node_nuci);
auto weight_nuci = std::get<2>(i1_node_nuci);
// helix
for (auto& j_2_node_nucj_2 : dfa.left_edges[j_1_node]){
NucType nucj_2 = std::get<1>(j_2_node_nucj_2);
for (auto& i2_node_nuci1 : dfa.right_edges[i1_node]){
NucType nuci1 = std::get<1>(i2_node_nuci1);
auto pair_nuc = NTP(nuci1, nucj_2);
NodeNucpair temp = {i1_node.first, i1_node.second, static_cast<NucPairType>(pair_nuc)};
auto& p_state = bestP[j_1_node][temp];
auto newscore = - func14(i, j-1, i+1, j-2,
nuci, nuci1, nucj_2, nucj_1,
nuci, nuci1, nucj_2, nucj_1)
+ p_state.score;
auto cai_score = p_state.cai_score + (weight_nuci + weight_nucj_1);
if (state.score == newscore && abs(state.cai_score - cai_score) < epsilon){
stk.push(make_tuple(i1_node, j_1_node, p_state, Beam_type::BEAM_P, pair_nuc));
sequence[i] = GET_ACGU(nuci);
sequence[j-1] = GET_ACGU(nucj_1);
structure[i] = '(';
structure[j-1] = ')';
no_backpointer = false;
break;
}
}if (!no_backpointer) break;
}if (!no_backpointer) break;
}
if (!no_backpointer) break;
// hairpin
NodeNucpair temp = {i_node.first, LinearDesign::NumType(i_node.second), curr_pair_nuc};
if (state.score == bestH[j_1_node][temp].score){ //no need to check CAI score here
for (auto& j_2_node_nucj_2 : dfa.left_edges[j_1_node]){
NucType nucj_2 = std::get<1>(j_2_node_nucj_2);
auto j_2_node = std::get<0>(j_2_node_nucj_2);
auto j_2 = j_2_node.first;
auto weight_nucj_2 = std::get<2>(j_2_node_nucj_2);
for (auto& i1_node_nuci : dfa.right_edges[i_node]){
NucType new_nuci = std::get<1>(i1_node_nuci);
if (new_nuci != nuci) continue;
auto i1_node = std::get<0>(i1_node_nuci);
auto weight_nuci = get<2>(i1_node_nuci);
for(auto& i2_node_nuci1 : dfa.right_edges[i1_node]){
NucType nuci1 = std::get<1>(i2_node_nuci1);
auto i2_node = std::get<0>(i2_node_nuci1);
auto i2 = i2_node.first;
auto weight_nuci1 = std::get<2>(i2_node_nuci1);
if (j - 1 - i == 4 and (j_2_node.second != i2_node.second and dfa.nodes[i+2].size() == dfa.nodes[j-2].size())) continue;
auto newscore = - func12(i, j-1, nuci, nuci1, nucj_2, nucj_1, tetra_hex_tri);
auto cai_score = weight_nuci + weight_nuci1 + get_broken_codon_score(i2_node, j_2_node) + weight_nucj_2 + weight_nucj_1;
if (state.score == newscore && abs(state.cai_score - cai_score) < epsilon){
sequence[i] = GET_ACGU(nuci);
sequence[i+1] = GET_ACGU(nuci1);
sequence[j-2] = GET_ACGU(nucj_2);
sequence[j-1] = GET_ACGU(nucj_1);
structure[i] = '(';
structure[j-1] = ')';
auto temp_string = get_nuc_from_dfa_cai<IndexType>(dfa, i2_node, j_2_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
int count = i2;
for (auto & nuc : temp_string ){
sequence[count] = nuc;
count++;
}
assert(count == j_2);
no_backpointer = false;
break;
}
}if (!no_backpointer) break;
}if (!no_backpointer) break;
}if (!no_backpointer) break;
}
}
// single branch
if (no_backpointer) {
vector<pair<IndexType, NucType>> right_seq;
vector<tuple<NodeType, NodeType, NucType, NucType, NucType, vector<pair<IndexType, NucType>>, int, int, NodeType, NodeType, double, double, double, double, bool, NodeType>> q_node_nucs_list;
for (IndexType q = j-1; q >= std::max(j - SINGLE_MAX_LEN - 1, i + 5); --q){
int right_start = -1;
int right_end = -1;
q_node_nucs_list.clear();
if (q == j-1){
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
if (get<1>(j_1_node_nucj_1) != nucj_1) continue;
auto q_node = get<0>(j_1_node_nucj_1);
auto weight_nucj_1 = get<2>(j_1_node_nucj_1);
for (auto& q_1_node_nucq_1 : dfa.left_edges[q_node]){
NodeType q_1_node = get<0>(q_1_node_nucq_1);
auto nucq_1 = get<1>(q_1_node_nucq_1);
double weight_nucq_1 = get<2>(q_1_node_nucq_1);
right_seq.push_back(make_pair(j-1, nucj_1));
q_node_nucs_list.push_back(make_tuple(q_1_node, q_node, nucq_1, nucj_1, nucq_1, right_seq, right_start, right_end, make_pair(-1,0), make_pair(-1,0), weight_nucq_1, 0., 0., weight_nucj_1, true, make_pair(-1,0)));
right_seq.clear();
}
}
}else if(q == j-2){
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
if (get<1>(j_1_node_nucj_1) != nucj_1) continue;
auto j_1_node = get<0>(j_1_node_nucj_1);
auto weight_nucj_1 = get<2>(j_1_node_nucj_1);
for (auto& q_node_nucq : dfa.left_edges[j_1_node]){
auto q_node = get<0>(q_node_nucq);
auto nucq = get<1>(q_node_nucq);
auto weight_nucq = get<2>(q_node_nucq);
for (auto& q_1_node_nucq_1 : dfa.left_edges[q_node]){
NodeType q_1_node = get<0>(q_1_node_nucq_1);
auto nucq_1 = get<1>(q_1_node_nucq_1);
double weight_nucq_1 = get<2>(q_1_node_nucq_1);
right_seq.push_back(make_pair(q, nucq));
right_seq.push_back(make_pair(j-1, nucj_1));
q_node_nucs_list.push_back(make_tuple(q_1_node, q_node, nucq_1, nucq, nucq, right_seq, right_start, right_end, make_pair(-1,0), make_pair(-1,0), weight_nucq_1, weight_nucq, 0., weight_nucj_1, false, j_1_node));
right_seq.clear();
}
}
}
}else if(q == j-3){
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
if (get<1>(j_1_node_nucj_1) != nucj_1) continue;
auto j_1_node = get<0>(j_1_node_nucj_1);
auto weight_nucj_1 = get<2>(j_1_node_nucj_1);
for(auto& j_2_node_nucj_2 : dfa.left_edges[j_1_node]){
auto j_2_node = get<0>(j_2_node_nucj_2);
auto nucj_2 = get<1>(j_2_node_nucj_2);
auto weight_nucj_2 = get<2>(j_2_node_nucj_2);
for (auto& q_node_nucq : dfa.left_edges[j_2_node]){
auto q_node = get<0>(q_node_nucq);
auto nucq = get<1>(q_node_nucq);
auto weight_nucq = get<2>(q_node_nucq);
for (auto& q_1_node_nucq_1 : dfa.left_edges[q_node]){
NodeType q_1_node = get<0>(q_1_node_nucq_1);
auto nucq_1 = get<1>(q_1_node_nucq_1);
double weight_nucq_1 = get<2>(q_1_node_nucq_1);
right_seq.push_back(make_pair(q, nucq));
right_seq.push_back(make_pair(j-2, nucj_2));
right_seq.push_back(make_pair(j-1, nucj_1));
q_node_nucs_list.push_back(make_tuple(q_1_node, q_node, nucq_1, nucq, nucj_2, right_seq, right_start, right_end, make_pair(-1,0), make_pair(-1,0), weight_nucq_1, weight_nucq, weight_nucj_2, weight_nucj_1, false, j_1_node));
right_seq.clear();
}
}
}
}
}
else if(q == j-4){
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
if (get<1>(j_1_node_nucj_1) != nucj_1) continue;
auto j_1_node = get<0>(j_1_node_nucj_1);
auto weight_nucj_1 = get<2>(j_1_node_nucj_1);
for(auto& j_2_node_nucj_2 : dfa.left_edges[j_1_node]){
auto j_2_node = get<0>(j_2_node_nucj_2);
auto nucj_2 = get<1>(j_2_node_nucj_2);
auto weight_nucj_2 = get<2>(j_2_node_nucj_2);
for(auto& j_3_node_nucj_3 : dfa.left_edges[j_2_node]){
auto j_3_node = get<0>(j_3_node_nucj_3);
for (auto& q_node_nucq : dfa.left_edges[j_3_node]){
auto q_node = get<0>(q_node_nucq);
auto nucq = get<1>(q_node_nucq);
auto weight_nucq = get<2>(q_node_nucq);
for (auto& q_1_node_nucq_1 : dfa.left_edges[q_node]){
NodeType q_1_node = get<0>(q_1_node_nucq_1);
auto nucq_1 = get<1>(q_1_node_nucq_1);
double weight_nucq_1 = get<2>(q_1_node_nucq_1);
right_seq.push_back(make_pair(q, nucq));
right_seq.push_back(make_pair(j-2, nucj_2));
right_seq.push_back(make_pair(j-1, nucj_1));
right_start = q+1;
right_end = j-2;
q_node_nucs_list.push_back(make_tuple(q_1_node, q_node, nucq_1, nucq, nucj_2, right_seq, right_start, right_end, j_3_node, j_2_node, weight_nucq_1, weight_nucq, weight_nucj_2, weight_nucj_1, false, j_1_node));
right_seq.clear();
}
}
}
}
}
}
else{
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
if (get<1>(j_1_node_nucj_1) != nucj_1) continue;
auto j_1_node = get<0>(j_1_node_nucj_1);
auto weight_nucj_1 = get<2>(j_1_node_nucj_1);
for(auto& j_2_node_nucj_2 : dfa.left_edges[j_1_node]){
auto j_2_node = get<0>(j_2_node_nucj_2);
auto nucj_2 = get<1>(j_2_node_nucj_2);
auto weight_nucj_2 = get<2>(j_2_node_nucj_2);
for (auto& q_node : dfa.nodes[q]){
for (auto& q1_node_nucq : dfa.right_edges[q_node]){
auto q1_node = get<0>(q1_node_nucq);
auto nucq = get<1>(q1_node_nucq);
auto weight_nucq = get<2>(q1_node_nucq);
for (auto& q_1_node_nucq_1 : dfa.left_edges[q_node]){
NodeType q_1_node = get<0>(q_1_node_nucq_1);
auto nucq_1 = get<1>(q_1_node_nucq_1);
double weight_nucq_1 = get<2>(q_1_node_nucq_1);
right_seq.push_back(make_pair(q, nucq));
right_seq.push_back(make_pair(j-2, nucj_2));
right_seq.push_back(make_pair(j-1, nucj_1));
right_start = q+1;
right_end = j-2;
q_node_nucs_list.push_back(make_tuple(q_1_node, q_node, nucq_1, nucq, nucj_2, right_seq, right_start, right_end, q1_node, j_2_node, weight_nucq_1, weight_nucq, weight_nucj_2, weight_nucj_1,false, j_1_node));
right_seq.clear();
}
}
}
}
}
}
for (auto& q_node_nucs : q_node_nucs_list){
auto q_1_node = get<0>(q_node_nucs);
auto q_node = get<1>(q_node_nucs);
auto nucq_1 = get<2>(q_node_nucs);
auto nucq = get<3>(q_node_nucs);
auto nucj_2 = get<4>(q_node_nucs);
auto right_seq = get<5>(q_node_nucs);
auto right_start = get<6>(q_node_nucs);
auto right_end = get<7>(q_node_nucs);
auto right_start_node = get<8>(q_node_nucs);
auto right_end_node = get<9>(q_node_nucs);
auto weight_nucq_1 = get<10>(q_node_nucs);
auto weight_nucq = get<11>(q_node_nucs);
auto weight_nucj_2 = get<12>(q_node_nucs);
auto weight_nucj_1 = get<13>(q_node_nucs);
bool q_equ_j_1 = get<14>(q_node_nucs);
auto j_1_node = get<15>(q_node_nucs);
double weight_right = 0.0;
double weight_left = 0.0;
if(q_equ_j_1){
for (auto& i1_node_nuci : dfa.right_edges[i_node]){
NucType new_nuci = get<1>(i1_node_nuci);
if (new_nuci != nuci) continue;
auto i1_node = get<0>(i1_node_nuci);
auto weight_nuci = get<2>(i1_node_nuci);
auto p_list = next_list[nucq_1][i1_node];
for (auto &p_node_nucp : p_list){
auto p_node = get<0>(p_node_nucp);
auto nucp = get<1>(p_node_nucp);
auto p = p_node.first;
PairType pair_nuc = NTP(nucp, nucq_1);
if (p == i + 1) continue; // stack
if (p - i + j - q - 2 > SINGLE_MAX_LEN) continue;
NodeNucpair temp = {p_node.first, p_node.second, static_cast<NucPairType>(pair_nuc)};
auto& p_state = bestP[q_node][temp];
auto newscore = - func14(i, j-1, p, q-1, nuci, nucp, nucq_1, nucj_1, nuci, nucp, nucq_1, nucj_1) + p_state.score;
auto weight_left = weight_nuci + get_broken_codon_score(i1_node, p_node);
auto cai_score = p_state.cai_score + (weight_left + weight_nucj_1);
if (state.score == newscore && abs(state.cai_score - cai_score) < epsilon){
stk.push(make_tuple(p_node, q_node, p_state, Beam_type::BEAM_P, pair_nuc));
sequence[i] = GET_ACGU(nuci);
auto temp_i1_to_p_nucs = get_nuc_from_dfa_cai<IndexType>(dfa, i1_node, p_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
assert(temp_i1_to_p_nucs.size() == p - (i+1));
auto count = i+1;
for (auto& nuc : temp_i1_to_p_nucs){
sequence[count] = nuc;
count++;
}
assert(count == p);
assert(right_seq.size() == 1);
sequence[j-1] = GET_ACGU(right_seq[0].second);
structure[i] = '(';
structure[j-1] = ')';
no_backpointer = false;
break;
}if (!no_backpointer) break;
}if (!no_backpointer) break;
}
}else{
for (auto& i1_node_nuci : dfa.right_edges[i_node]){
NucType new_nuci = get<1>(i1_node_nuci);
if (new_nuci != nuci) continue;
auto i1_node = get<0>(i1_node_nuci);
auto weight_nuci = get<2>(i1_node_nuci);
auto p_list = next_list[nucq_1][i1_node];
for (auto &p_node_nucp : p_list){
auto p_node = get<0>(p_node_nucp);
auto nucp = get<1>(p_node_nucp);
auto weight_nucp = get<2>(p_node_nucp);
auto p = p_node.first;
PairType pair_nuc = NTP(nucp, nucq_1);
if (p - i + j - q - 2 > SINGLE_MAX_LEN) continue;
NodeNucpair temp = {p_node.first, p_node.second, static_cast<NucPairType>(pair_nuc)};
auto& p_state = bestP[q_node][temp];
auto newscore = 0;
if (p == i+1){
newscore = - func14(i, j-1, p, q-1, nuci, nucp, nucj_2, nucj_1, nuci, nucp, nucq_1, nucq)
+ p_state.score;
weight_right = get_broken_codon_score(q_node,j_1_node) + weight_nucj_1;
auto cai_score = p_state.cai_score + (weight_nuci + weight_right);
if (state.score == newscore && abs(state.cai_score - cai_score) < epsilon){
stk.push(make_tuple(p_node, q_node, p_state, Beam_type::BEAM_P, pair_nuc));
sequence[i] = GET_ACGU(nuci);
for(auto& idx_nucidx : right_seq){
IndexType idx = idx_nucidx.first;
NucType nucidx = idx_nucidx.second;
sequence[idx] = GET_ACGU(nucidx);
}
structure[i] = '(';
structure[j-1] = ')';
auto temp_string = get_nuc_from_dfa_cai<IndexType>(dfa, q_node, j_1_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
int count = q;
for (auto & nuc : temp_string ){
sequence[count] = nuc;
count++;
}
assert(count == j-1);
no_backpointer = false;
break;
}
}else if(p == i+2){
for (auto& i2_node_nuci1 : dfa.right_edges[i1_node]){
auto i2_node = get<0>(i2_node_nuci1);
if (p_node != i2_node) continue;
NucType nuci1 = get<1>(i2_node_nuci1);
auto weight_nuci1 = get<2>(i2_node_nuci1);
newscore = - func14(i, j-1, p, q-1, nuci, nuci1, nucj_2, nucj_1, nuci1, nucp, nucq_1, nucq)
+ p_state.score;
weight_left = weight_nuci + weight_nuci1;
weight_right = weight_nucq + get_broken_codon_score(right_start_node, right_end_node) + weight_nucj_2 + weight_nucj_1;
auto cai_score = p_state.cai_score + (weight_left + weight_right);
if (state.score == newscore && abs(state.cai_score - cai_score) < epsilon){
stk.push(make_tuple(p_node, q_node, p_state, Beam_type::BEAM_P, pair_nuc));
sequence[i] = GET_ACGU(nuci);
sequence[i+1] = GET_ACGU(nuci1);
for(auto& idx_nucidx : right_seq){
IndexType idx = idx_nucidx.first;
NucType nucidx = idx_nucidx.second;
sequence[idx] = GET_ACGU(nucidx);
}
structure[i] = '(';
structure[j-1] = ')';
auto temp_string = get_nuc_from_dfa_cai<IndexType>(dfa, right_start_node, right_end_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
int count = right_start;
for (auto & nuc : temp_string ){
sequence[count] = nuc;
count++;
}
assert(count == right_end);
no_backpointer = false;
break;
}
}
}else if(p == i+3){
for (auto& p_1_node_nucp_1 : dfa.left_edges[p_node]){
auto p_1_node = get<0>(p_1_node_nucp_1);
auto nucp_1 = get<1>(p_1_node_nucp_1);
auto weight_nucp_1 = get<2>(p_1_node_nucp_1);
for (auto& i2_node_nuci1 : dfa.right_edges[i1_node]){
auto i2_node = get<0>(i2_node_nuci1);
if (p_1_node != i2_node) continue;
NucType nuci1 = get<1>(i2_node_nuci1);
auto weight_nuci1 = get<2>(i2_node_nuci1);
newscore = - func14(i, j-1, p, q-1, nuci, nuci1, nucj_2, nucj_1, nucp_1, nucp, nucq_1, nucq)
+ p_state.score;
weight_left = weight_nuci + weight_nuci1 + weight_nucp_1;
weight_right = weight_nucq + get_broken_codon_score(right_start_node,right_end_node) + weight_nucj_2 + weight_nucj_1;
auto cai_score = p_state.cai_score + (weight_left + weight_right);
if (state.score == newscore && abs(state.cai_score - cai_score) < epsilon){
stk.push(make_tuple(p_node, q_node, p_state, Beam_type::BEAM_P, pair_nuc));
sequence[i] = GET_ACGU(nuci);
sequence[i+1] = GET_ACGU(nuci1);
sequence[p-1] = GET_ACGU(nucp_1);
for(auto& idx_nucidx : right_seq){
IndexType idx = idx_nucidx.first;
NucType nucidx = idx_nucidx.second;
sequence[idx] = GET_ACGU(nucidx);
}
structure[i] = '(';
structure[j-1] = ')';
auto temp_string = get_nuc_from_dfa_cai<IndexType>(dfa, right_start_node, right_end_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
int count = right_start;
for (auto & nuc : temp_string ){
sequence[count] = nuc;
count++;
}
assert(count == right_end);
no_backpointer = false;
break;
}
}if (!no_backpointer) break;
}
}else if(p == i+4){
for (auto& p_1_node_nucp_1 : dfa.left_edges[p_node]){
auto p_1_node = get<0>(p_1_node_nucp_1);
auto nucp_1 = get<1>(p_1_node_nucp_1);
auto weight_nucp_1 = get<2>(p_1_node_nucp_1);
for (auto& i2_node_nuci1 : dfa.right_edges[i1_node]){
auto i2_node = get<0>(i2_node_nuci1);
NucType nuci1 = get<1>(i2_node_nuci1);
auto weight_nuci1 = get<2>(i2_node_nuci1);
for (auto& i3_node_nuci2 : dfa.right_edges[i2_node]){
auto i3_node = get<0>(i3_node_nuci2);
if (i3_node != p_1_node) continue;
auto nuci2 = get<1>(i3_node_nuci2);
auto weight_nuci2 = get<2>(i3_node_nuci2);
newscore = - func14(i, j-1, p, q-1, nuci, nuci1, nucj_2, nucj_1, nucp_1, nucp, nucq_1, nucq)
+ p_state.score;
weight_left = weight_nuci + weight_nuci1 + weight_nuci2 + weight_nucp_1;
weight_right = weight_nucq + get_broken_codon_score(right_start_node,right_end_node) + weight_nucj_2 + weight_nucj_1;
auto cai_score = p_state.cai_score + (weight_left + weight_right);
if (state.score == newscore && abs(state.cai_score - cai_score) < epsilon){
stk.push(make_tuple(p_node, q_node, p_state, Beam_type::BEAM_P, pair_nuc));
sequence[i] = GET_ACGU(nuci);
sequence[i+1] = GET_ACGU(nuci1);
sequence[i+2] = GET_ACGU(nuci2);
sequence[p-1] = GET_ACGU(nucp_1);
for(auto& idx_nucidx : right_seq){
IndexType idx = idx_nucidx.first;
NucType nucidx = idx_nucidx.second;
sequence[idx] = GET_ACGU(nucidx);
}
structure[i] = '(';
structure[j-1] = ')';
auto temp_string = get_nuc_from_dfa_cai<IndexType>(dfa, right_start_node, right_end_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
auto count = right_start;
for (auto & nuc : temp_string ){
sequence[count] = nuc;
count++;
}
assert(count == right_end);
no_backpointer = false;
break;
}
}if (!no_backpointer) break;
}if (!no_backpointer) break;
}
}else{
for (auto& i2_node_nuci1 : dfa.right_edges[i1_node]){
NucType nuci1 = get<1>(i2_node_nuci1);
auto i2_node = get<0>(i2_node_nuci1);
auto weight_nuci1 = get<2>(i2_node_nuci1);
for (auto& p_1_node_nucp_1 : dfa.left_edges[p_node]){
auto nucp_1 = get<1>(p_1_node_nucp_1);
auto p_1_node = get<0>(p_1_node_nucp_1);
auto weight_nucp_1 = get<2>(p_1_node_nucp_1);
newscore = - func14(i, j-1, p, q-1, nuci, nuci1, nucj_2, nucj_1, nucp_1, nucp, nucq_1, nucq)
+ p_state.score;
weight_left = weight_nuci + weight_nuci1 + get_broken_codon_score(i2_node, p_1_node) + weight_nucp_1;
weight_right = weight_nucq + get_broken_codon_score(right_start_node,right_end_node) + weight_nucj_2 + weight_nucj_1;
auto cai_score = p_state.cai_score + (weight_left + weight_right);
if (state.score == newscore && abs(state.cai_score - cai_score) < epsilon){
stk.push(make_tuple(p_node, q_node, p_state, Beam_type::BEAM_P, pair_nuc));
sequence[i] = GET_ACGU(nuci);
sequence[i+1] = GET_ACGU(nuci1);
sequence[p-1] = GET_ACGU(nucp_1);
auto temp_string = get_nuc_from_dfa_cai<IndexType>(dfa, i2_node, p_1_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
int count = i+2;
for (auto & nuc : temp_string ){
sequence[count] = nuc;
count++;
}
assert(count == p-1);
for(auto& idx_nucidx : right_seq){
IndexType idx = idx_nucidx.first;
NucType nucidx = idx_nucidx.second;
sequence[idx] = GET_ACGU(nucidx);
}
structure[i] = '(';
structure[j-1] = ')';
temp_string = get_nuc_from_dfa_cai<IndexType>(dfa, right_start_node, right_end_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
count = right_start;
for (auto & nuc : temp_string ){
sequence[count] = nuc;
count++;
}
assert(count == right_end);
no_backpointer = false;
break;
}
}if (!no_backpointer) break;
}
}if (!no_backpointer) break;
}if (!no_backpointer) break;
}if (!no_backpointer) break;
}
}if (!no_backpointer) break;
}
}
// Multi
if (no_backpointer){
NodeNucpair temp = {i_node.first, i_node.second, static_cast<NucPairType>(curr_pair_nuc)};
auto& multi_state = bestMulti[j_node][temp];
auto newscore = multi_state.score - func15(i, j, nuci, -1, -1, nucj_1, seq_length);
if (state.score == newscore && abs(state.cai_score - multi_state.cai_score) < epsilon){
stk.push(make_tuple(i_node, j_node, multi_state, Beam_type::BEAM_MULTI, curr_pair_nuc));
sequence[i] = GET_ACGU(nuci);
sequence[j-1] = GET_ACGU(nucj_1);
structure[i] = '(';
structure[j-1] = ')';
no_backpointer = false;
}
}
assert(no_backpointer == false);
break;
case Beam_type::BEAM_MULTI:
nuci = PTLN(curr_pair_nuc);
nucj_1 = PTRN(curr_pair_nuc);
j = j_node.first;
i = i_node.first;
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
auto j_1_node = get<0>(j_1_node_nucj_1);
auto weight_nucj_1 = get<2>(j_1_node_nucj_1);
NodeType q_node = state.pre_node;
q = q_node.first;
if(q == j - 1 and q_node != j_1_node) continue;
if(q == j - 2 and dfa.nodes[q].size() == dfa.nodes[j-1].size() and q_node.second != j_1_node.second) continue;
for (size_t p_node_ = 0; p_node_ < 2 * q; ++p_node_) {
auto& temp_state = bestM2[q_node][p_node_];
if (temp_state.score == util::value_min<ScoreType>())
continue;
auto p_node = reverse_index2(p_node_);
auto p = p_node.first;
if(p <= i) continue;
for (auto& i1_node_nuci : dfa.right_edges[i_node]){
auto i1_node = get<0>(i1_node_nuci);
if(p == i + 1 and p_node != i1_node) continue;
if(p == i + 2 and dfa.nodes[p].size() == dfa.nodes[i+1].size() and p_node.second != i1_node.second) continue;
double weight_nuci = double(get<2>(i1_node_nuci));
auto& m2_state = bestM2[q_node][p_node];
auto cai_score = m2_state.cai_score + (weight_nuci + get_broken_codon_score(i1_node, p_node) + get_broken_codon_score(q_node, j_1_node) + weight_nucj_1);
if (state.score == m2_state.score && abs(state.cai_score - cai_score) < epsilon){
stk.push(make_tuple(p_node, q_node, m2_state, Beam_type::BEAM_M2, -1));
auto temp_string = get_nuc_from_dfa_cai<IndexType>(dfa, i1_node, p_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
auto count = i+1;
for (auto & nuc : temp_string ){
sequence[count] = nuc;
count++;
}
assert(count == p);
temp_string.clear();
temp_string = get_nuc_from_dfa_cai<IndexType>(dfa, q_node, j_1_node, protein, best_path_in_one_codon_unit, aa_best_path_in_a_whole_codon);
count = q;
for (auto & nuc : temp_string ){
sequence[count] = nuc;
count++;
}
assert(count == j-1);
no_backpointer = false;
}if (!no_backpointer) break;
}if (!no_backpointer) break;
}if (!no_backpointer) break;
}
assert(no_backpointer == false);
break;
case Beam_type::BEAM_M2:
// M2 = M + P
i = i_node.first;
j = j_node.first;
for (size_t m_node_nucpair_ = 0; m_node_nucpair_ < 16 * j; ++m_node_nucpair_){
auto& p_state = bestP[j_node][m_node_nucpair_];
if (p_state.score == util::value_min<ScoreType>())
continue;
auto m_node_nucpair = reverse_index(m_node_nucpair_);
auto m = m_node_nucpair.node_first;
auto m_num = m_node_nucpair.node_second;
auto m_node = make_pair(m, m_num);
auto pair_nuc = m_node_nucpair.nucpair;
if (m <= i+4) continue; // no sharpturn
auto nucm = PTLN(pair_nuc);
auto nucj_1 = PTRN(pair_nuc);
auto newscore = - func6(-1, -1, -1, -1, nucm, nucj_1, -1, seq_length) + p_state.score;
auto& m_state = bestM[m_node][i_node];
auto cai_score = m_state.cai_score + p_state.cai_score;
if (state.score == m_state.score + newscore && state.cai_score == cai_score){
stk.push(make_tuple(i_node, m_node, m_state, Beam_type::BEAM_M1, -1));
stk.push(make_tuple(m_node, j_node, p_state, Beam_type::BEAM_P, pair_nuc));
no_backpointer = false;
break;
}
if (!no_backpointer) break;
}
assert(no_backpointer == false);
break;
case Beam_type::BEAM_M1:
// M = M + U
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
auto j_1_node = std::get<0>(j_1_node_nucj_1);
auto weight_nucj_1 = std::get<2>(j_1_node_nucj_1);
auto& m_state = bestM[j_1_node][i_node];
auto cai_score = m_state.cai_score + weight_nucj_1;
if (state.score == m_state.score && abs(state.cai_score - cai_score) < epsilon) {
NucType nucj_1 = std::get<1>(j_1_node_nucj_1);
stk.push(make_tuple(i_node, j_1_node, m_state, Beam_type::BEAM_M1, -1));
sequence[j-1] = GET_ACGU(nucj_1);
no_backpointer = false;
break;
}
}
// M = P
if(no_backpointer){
for (auto& j_1_node_nucj_1 : dfa.left_edges[j_node]){
NucType nucj_1 = std::get<1>(j_1_node_nucj_1);
for (auto& i1_node_nuci : dfa.right_edges[i_node]){
NucType nuci = std::get<1>(i1_node_nuci);
PairType pair_nuc = NTP(nuci, nucj_1);
NodeNucpair temp = {i_node.first, i_node.second, static_cast<NucPairType>(pair_nuc)};
auto& p_state = bestP[j_node][temp];
auto newscore = - func6(-1, -1, -1, -1, nuci, nucj_1, -1, seq_length) + p_state.score;
if (state.score == newscore && abs(state.cai_score - p_state.cai_score) < epsilon) {
stk.push(make_tuple(i_node, j_node, p_state, Beam_type::BEAM_P, pair_nuc));
no_backpointer = false;
break;
}
}if(!no_backpointer) break;
}
}
// M = M2
if(no_backpointer){
auto& m2_state = bestM2[j_node][i_node];
if (state.score == m2_state.score && state.cai_score == m2_state.cai_score) {
stk.push(make_tuple(i_node, j_node, m2_state, Beam_type::BEAM_M2, -1));
no_backpointer = false;
}
}
assert(no_backpointer == false);
break;
default: // MANNER_NONE or other cases
printf("wrong beam_type at %d, %d\n", i, j); fflush(stdout);
assert(false);
}
}
assert(string(sequence).size() == string(structure).size());
return {string(sequence), string(structure)};
}
}
================================================
FILE: src/beam_cky_parser.cc
================================================
#include <fstream>
#include <iostream>
#include <sys/time.h>
#include <stack>
#include <tuple>
#include <cassert>
#include <unordered_map>
#include <algorithm>
#include <string>
#include <map>
#include <set>
#include <unordered_set>
#include <chrono>
#include <string>
#include "beam_cky_parser.h"
#include "Utils/utility_v.h"
#include "backtrace_iter.cc"
#include "Utils/common.h"
using namespace std;
using NodeType = std::pair<LinearDesign::IndexType, LinearDesign::NumType>;
#define tetra_hex_tri -1
namespace LinearDesign {
template <typename ScoreType, typename IndexType, typename NodeType>
double BeamCKYParser<ScoreType, IndexType, NodeType>::get_broken_codon_score(
const NodeType& start_node, const NodeType& end_node) {
IndexType s_index = start_node.first;
IndexType t_index = end_node.first;
if (s_index >= t_index)
return 0.0;
auto aa_left = protein[s_index / 3]; // tri letter
auto aa_right = protein[(int)(s_index / 3)];
if (t_index / 3 < protein.size()){
aa_right = protein[(int)(t_index / 3)];
}
auto start_node_re_index = make_pair(s_index % 3, start_node.second);
auto end_node_re_index = make_pair(t_index % 3, end_node.second);
double ret = 0.0;
if (t_index - s_index < 3) {
if (s_index / 3 == t_index / 3) {
ret = std::get<0>(best_path_in_one_codon_unit[aa_left][make_tuple(start_node_re_index,end_node_re_index)]);
}else{
double left_ln_cai = 0.0, right_ln_cai = 0.0;
if (s_index % 3 != 0)
left_ln_cai = std::get<0>(best_path_in_one_codon_unit[aa_left][make_tuple(start_node_re_index,make_pair(0, 0))]);
if (t_index % 3 != 0)
right_ln_cai = std::get<0>(best_path_in_one_codon_unit[aa_right][make_tuple(make_pair(0, 0), end_node_re_index)]);
ret = left_ln_cai + right_ln_cai;
}
}else{
double left_ln_cai = 0.0, right_ln_cai = 0.0;
if (s_index % 3 != 0)
left_ln_cai = std::get<0>(best_path_in_one_codon_unit[aa_left][make_tuple(start_node_re_index,make_pair(0, 0))]);
if (t_index % 3 != 0)
right_ln_cai = std::get<0>(best_path_in_one_codon_unit[aa_right][make_tuple(make_pair(0, 0), end_node_re_index)]);
ret = left_ln_cai + right_ln_cai;
}
return ret;
}
template <typename ScoreType, typename IndexType, typename NodeType>
template <IndexType j_num>
void BeamCKYParser<ScoreType, IndexType, NodeType>::hairpin_beam(IndexType j, DFA_t& dfa) {
auto j_node = make_pair(j,j_num);
for (auto &j1_node_nucj : dfa.right_edges[j_node]) { // right_edges[j][j_num][j1_num][nuc]: false/true
auto j1_node = std::get<0>(j1_node_nucj);
auto nucj = std::get<1>(j1_node_nucj);
auto weight_nucj = std::get<2>(j1_node_nucj);
for (auto &j4_node : dfa.nodes[j+4]){
const auto& jnext_list = next_pair[nucj][j4_node];
if (jnext_list.empty())
continue;
for (auto &jnext_node_nucjnext : jnext_list){
auto jnext_node = std::get<0>(jnext_node_nucjnext);
auto nucjnext = std::get<1>(jnext_node_nucjnext);
auto weight_nucjnext = std::get<2>(jnext_node_nucjnext);
auto jnext = jnext_node.first;
IndexType hairpin_length = jnext + 1 - j; //special hairpin
NodeNucpair temp = {j, j_num, static_cast<NucPairType>(NTP(nucj, nucjnext))};
#ifdef SPECIAL_HP
if (hairpin_length == 5 or hairpin_length == 6 or hairpin_length == 8){
for(auto & seq_score_weight : hairpin_seq_score_cai[j_node][jnext_node][NTP(nucj, nucjnext)]){
auto seq = get<0>(seq_score_weight);
auto pre_cal_score = get<1>(seq_score_weight);
auto pre_cal_cai_score = get<2>(seq_score_weight);
update_if_better(bestH[jnext_node][temp], pre_cal_score, pre_cal_cai_score);
}
continue;
}
#endif
for (auto &j2_node_nucj1 : dfa.right_edges[j1_node]) {
auto j2_node = std::get<0>(j2_node_nucj1);
auto j2_num = j2_node.second;
auto nucj1 = std::get<1>(j2_node_nucj1);
auto weight_nucj1 = std::get<2>(j2_node_nucj1);
for (auto& jnext_1_node_list : dfa.auxiliary_left_edges[jnext_node]){
NodeType jnext_1_node = jnext_1_node_list.first;
NumType jnext_1_num = jnext_1_node.second;
if (jnext - j == 4 and (jnext_1_num != j2_num and dfa.nodes[j+2].size() == dfa.nodes[jnext-1].size())) continue;
for (auto& nucjnext_1_weight : jnext_1_node_list.second){
IndexType nucjnext_1 = get<0>(nucjnext_1_weight);
auto weight_nucjnext_1 = get<1>(nucjnext_1_weight);
auto newscore = - func12(j, jnext, nucj, nucj1, nucjnext_1, nucjnext, tetra_hex_tri);
FinalScoreType cai_score = weight_nucj + weight_nucj1 + weight_nucjnext_1 + weight_nucjnext; //ZL need to add weight_nucjnext
if ((jnext_1_node.first - j2_node.first) <= SINGLE_MAX_LEN)
cai_score += get_broken_codon_score_map[j2_node][jnext_1_node];
else
cai_score += get_broken_codon_score(j2_node,jnext_1_node);
update_if_better(bestH[jnext_node][temp], newscore, cai_score);
}
}
}
}
}
}
// for every state h in H[j]
// 1. extend h(i, j) to h(i, jnext)
// 2. generate p(i, j)
for (size_t i_node_nucpair_ = 0; i_node_nucpair_ < 16 * j; ++i_node_nucpair_) {
if (bestH[j_node][i_node_nucpair_].score == util::value_min<ScoreType>())
continue;
auto i_node_nucpair = reverse_index(i_node_nucpair_);
auto i = i_node_nucpair.node_first;
auto i_num = i_node_nucpair.node_second;
auto pair_nuc = i_node_nucpair.nucpair;
auto i_node = make_pair(i,i_num);
auto nuci = PTLN(pair_nuc);
auto nucj = PTRN(pair_nuc);
for (const auto& item : dfa.auxiliary_right_edges[j_node]){
auto j1_node = item.first;
auto jnext_list = next_pair[nuci][j1_node];
if (jnext_list.empty()) continue;
for (auto &jnext_node_nucjnext : jnext_list){
auto jnext_node = std::get<0>(jnext_node_nucjnext);
auto nucjnext = std::get<1>(jnext_node_nucjnext);
auto jnext = jnext_node.first;
auto weight_nucjnext = std::get<2>(jnext_node_nucjnext);
auto hairpin_length = jnext + 1 - i;
NodeNucpair temp = {i, i_num, static_cast<NucPairType>(NTP(nuci, nucjnext))};
#ifdef SPECIAL_HP
if (hairpin_length == 5 or hairpin_length == 6 or hairpin_length == 8){
for(auto & seq_score_weight : hairpin_seq_score_cai[i_node][jnext_node][NTP(nuci, nucjnext)]){
auto seq = get<0>(seq_score_weight);
auto pre_cal_score = get<1>(seq_score_weight);
auto pre_cal_cai_score = get<2>(seq_score_weight);
update_if_better(bestH[jnext_node][temp], pre_cal_score, pre_cal_cai_score);
}
continue;
}
#endif
for (auto &i1_node_newnuci : dfa.right_edges[i_node]){
NucType newnuci = get<1>(i1_node_newnuci);
if (nuci != newnuci) continue;
NodeType i1_node = get<0>(i1_node_newnuci);
double weight_newnuci = get<2>(i1_node_newnuci);
for (auto &i2_node_nuci1 : dfa.right_edges[i1_node]) {
auto i2_node = get<0>(i2_node_nuci1);
auto nuci1 = get<1>(i2_node_nuci1);
auto weight_nuci1 = get<2>(i2_node_nuci1);
for (auto &jnext_1_node_nucjnext_1 : dfa.left_edges[jnext_node]) {
auto jnext_1_node = get<0>(jnext_1_node_nucjnext_1);
auto nucjnext_1 = get<1>(jnext_1_node_nucjnext_1);
auto weight_nucjnext_1 = get<2>(jnext_1_node_nucjnext_1);
auto newscore = - func12(i, jnext, nuci, nuci1, nucjnext_1, nucjnext, tetra_hex_tri);
FinalScoreType cai_score = weight_newnuci + weight_nuci1 + weight_nucjnext_1 + weight_nucjnext; //move weight_nucjnext from H to P to here. Since we added SH here, so it must be
gitextract_f87ovany/ ├── .gitattributes ├── Makefile ├── README.md ├── coding_wheel.txt ├── codon_usage_freq_table_human.csv ├── codon_usage_freq_table_yeast.csv ├── gflags.py ├── license.txt ├── lineardesign ├── src/ │ ├── Utils/ │ │ ├── base.h │ │ ├── codon.h │ │ ├── common.h │ │ ├── constants.h │ │ ├── flat.h │ │ ├── network.h │ │ ├── reader.h │ │ └── utility_v.h │ ├── backtrace_iter.cc │ ├── beam_cky_parser.cc │ ├── beam_cky_parser.h │ └── linear_design.cpp └── testseq
SYMBOL INDEX (170 symbols across 12 files)
FILE: gflags.py
function bool (line 323) | def bool(x):
function _GetCallingModule (line 333) | def _GetCallingModule():
class FlagsError (line 349) | class FlagsError(Exception):
class DuplicateFlag (line 354) | class DuplicateFlag(FlagsError):
class DuplicateFlagError (line 362) | class DuplicateFlagError(DuplicateFlag):
method __init__ (line 364) | def __init__(self, flagname, flag_values):
class IllegalFlagValue (line 377) | class IllegalFlagValue(FlagsError):
class UnrecognizedFlag (line 382) | class UnrecognizedFlag(FlagsError):
class UnrecognizedFlagError (line 390) | class UnrecognizedFlagError(UnrecognizedFlag):
method __init__ (line 391) | def __init__(self, flagname):
function GetHelpWidth (line 402) | def GetHelpWidth():
function CutCommonSpacePrefix (line 407) | def CutCommonSpacePrefix(text):
function TextWrap (line 450) | def TextWrap(text, length=None, indent='', firstline_indent=None, tabs='...
function DocToHelp (line 563) | def DocToHelp(doc):
function __GetModuleName (line 589) | def __GetModuleName(globals_dict):
function _GetMainModule (line 608) | def _GetMainModule():
class FlagValues (line 618) | class FlagValues:
method __init__ (line 651) | def __init__(self):
method FlagDict (line 664) | def FlagDict(self):
method FlagsByModuleDict (line 667) | def FlagsByModuleDict(self):
method KeyFlagsByModuleDict (line 676) | def KeyFlagsByModuleDict(self):
method _RegisterFlagByModule (line 685) | def _RegisterFlagByModule(self, module_name, flag):
method _RegisterKeyFlagForModule (line 698) | def _RegisterKeyFlagForModule(self, module_name, flag):
method _GetFlagsDefinedByModule (line 712) | def _GetFlagsDefinedByModule(self, module):
method _GetKeyFlagsForModule (line 728) | def _GetKeyFlagsForModule(self, module):
method AppendFlagValues (line 753) | def AppendFlagValues(self, flag_values):
method __setitem__ (line 768) | def __setitem__(self, name, flag):
method __getitem__ (line 792) | def __getitem__(self, name):
method __getattr__ (line 796) | def __getattr__(self, name):
method __setattr__ (line 803) | def __setattr__(self, name, value):
method _FlagIsRegistered (line 809) | def _FlagIsRegistered(self, flag_obj):
method __delattr__ (line 838) | def __delattr__(self, flag_name):
method __RemoveFlagFromDictByModule (line 871) | def __RemoveFlagFromDictByModule(self, flags_by_module_dict, flag_obj):
method SetDefault (line 885) | def SetDefault(self, name, value):
method __contains__ (line 892) | def __contains__(self, name):
method __iter__ (line 898) | def __iter__(self):
method __call__ (line 902) | def __call__(self, argv):
method __call2__ (line 914) | def __call2__(self, argv):
method Reset (line 1052) | def Reset(self):
method RegisteredFlags (line 1057) | def RegisteredFlags(self):
method FlagValuesDict (line 1061) | def FlagValuesDict(self):
method __str__ (line 1071) | def __str__(self):
method GetHelp (line 1075) | def GetHelp(self, prefix=''):
method __RenderModuleFlags (line 1106) | def __RenderModuleFlags(self, module, flags, output_lines, prefix=""):
method __RenderOurModuleFlags (line 1111) | def __RenderOurModuleFlags(self, module, output_lines, prefix=""):
method __RenderOurModuleKeyFlags (line 1117) | def __RenderOurModuleKeyFlags(self, module, output_lines, prefix=""):
method MainModuleHelp (line 1130) | def MainModuleHelp(self):
method __RenderFlagList (line 1136) | def __RenderFlagList(self, flaglist, output_lines, prefix=" "):
method get (line 1179) | def get(self, name, default):
method ShortestUniquePrefixes (line 1193) | def ShortestUniquePrefixes(self, fl):
method __IsFlagFileDirective (line 1229) | def __IsFlagFileDirective(self, flag_string):
method ExtractFilename (line 1244) | def ExtractFilename(self, flagfile_str):
method __GetFlagFileLines (line 1258) | def __GetFlagFileLines(self, filename, parsed_file_list):
method ReadFlagsFromFiles (line 1314) | def ReadFlagsFromFiles(self, argv):
method FlagsIntoString (line 1369) | def FlagsIntoString(self):
method AppendFlagsIntoFile (line 1384) | def AppendFlagsIntoFile(self, filename):
method WriteHelpInXMLFormat (line 1396) | def WriteHelpInXMLFormat(self, outfile=None):
function _MakeXMLSafe (line 1448) | def _MakeXMLSafe(s):
function _WriteSimpleXMLElement (line 1461) | def _WriteSimpleXMLElement(outfile, name, value, indent):
class Flag (line 1479) | class Flag:
method __init__ (line 1513) | def __init__(self, parser, serializer, name, default, help_string,
method __GetParsedValueAsString (line 1531) | def __GetParsedValueAsString(self, value):
method Parse (line 1543) | def Parse(self, argument):
method Unparse (line 1550) | def Unparse(self):
method Serialize (line 1557) | def Serialize(self):
method SetDefault (line 1570) | def SetDefault(self, value):
method Type (line 1584) | def Type(self):
method WriteInfoInXMLFormat (line 1591) | def WriteInfoInXMLFormat(self, outfile, module_name, is_key=False, ind...
method _WriteCustomInfoInXMLFormat (line 1625) | def _WriteCustomInfoInXMLFormat(self, outfile, indent):
class ArgumentParser (line 1640) | class ArgumentParser:
method Parse (line 1653) | def Parse(self, argument):
method Type (line 1657) | def Type(self):
method WriteCustomInfoInXMLFormat (line 1660) | def WriteCustomInfoInXMLFormat(self, outfile, indent):
class ArgumentSerializer (line 1664) | class ArgumentSerializer:
method Serialize (line 1667) | def Serialize(self, value):
class ListSerializer (line 1671) | class ListSerializer(ArgumentSerializer):
method __init__ (line 1673) | def __init__(self, list_sep):
method Serialize (line 1676) | def Serialize(self, value):
function DEFINE (line 1683) | def DEFINE(parser, name, default, help, flag_values=FLAGS, serializer=None,
function DEFINE_flag (line 1707) | def DEFINE_flag(flag, flag_values=FLAGS):
function _InternalDeclareKeyFlags (line 1731) | def _InternalDeclareKeyFlags(flag_names, flag_values=FLAGS):
function DECLARE_key_flag (line 1756) | def DECLARE_key_flag(flag_name, flag_values=FLAGS):
function ADOPT_module_key_flags (line 1779) | def ADOPT_module_key_flags(module, flag_values=FLAGS):
function DEFINE_string (line 1807) | def DEFINE_string(name, default, help, flag_values=FLAGS, **args):
class BooleanParser (line 1819) | class BooleanParser(ArgumentParser):
method Convert (line 1822) | def Convert(self, argument):
method Parse (line 1838) | def Parse(self, argument):
method Type (line 1842) | def Type(self):
class BooleanFlag (line 1846) | class BooleanFlag(Flag):
method __init__ (line 1859) | def __init__(self, name, default, help, short_name=None, **args):
function DEFINE_boolean (line 1865) | def DEFINE_boolean(name, default, help, flag_values=FLAGS, **args):
class HelpFlag (line 1881) | class HelpFlag(BooleanFlag):
method __init__ (line 1888) | def __init__(self):
method Parse (line 1891) | def Parse(self, arg):
class HelpXMLFlag (line 1903) | class HelpXMLFlag(BooleanFlag):
method __init__ (line 1906) | def __init__(self):
method Parse (line 1911) | def Parse(self, arg):
class HelpshortFlag (line 1917) | class HelpshortFlag(BooleanFlag):
method __init__ (line 1925) | def __init__(self):
method Parse (line 1928) | def Parse(self, arg):
class FloatParser (line 1943) | class FloatParser(ArgumentParser):
method __init__ (line 1952) | def __init__(self, lower_bound=None, upper_bound=None):
method Convert (line 1970) | def Convert(self, argument):
method Parse (line 1974) | def Parse(self, argument):
method Type (line 1981) | def Type(self):
method WriteCustomInfoInXMLFormat (line 1984) | def WriteCustomInfoInXMLFormat(self, outfile, indent):
function DEFINE_float (line 1992) | def DEFINE_float(name, default, help, lower_bound=None, upper_bound=None,
class IntegerParser (line 2009) | class IntegerParser(FloatParser):
method Convert (line 2018) | def Convert(self, argument):
method Type (line 2036) | def Type(self):
function DEFINE_integer (line 2040) | def DEFINE_integer(name, default, help, lower_bound=None, upper_bound=None,
class EnumParser (line 2057) | class EnumParser(ArgumentParser):
method __init__ (line 2063) | def __init__(self, enum_values=None):
method Parse (line 2066) | def Parse(self, argument):
method Type (line 2072) | def Type(self):
class EnumFlag (line 2076) | class EnumFlag(Flag):
method __init__ (line 2079) | def __init__(self, name, default, help, enum_values=None,
method _WriteCustomInfoInXMLFormat (line 2088) | def _WriteCustomInfoInXMLFormat(self, outfile, indent):
function DEFINE_enum (line 2093) | def DEFINE_enum(name, default, enum_values, help, flag_values=FLAGS,
class BaseListParser (line 2105) | class BaseListParser(ArgumentParser):
method __init__ (line 2116) | def __init__(self, token=None, name=None):
method Parse (line 2122) | def Parse(self, argument):
method Type (line 2128) | def Type(self):
class ListParser (line 2132) | class ListParser(BaseListParser):
method __init__ (line 2135) | def __init__(self):
method WriteCustomInfoInXMLFormat (line 2138) | def WriteCustomInfoInXMLFormat(self, outfile, indent):
class WhitespaceSeparatedListParser (line 2143) | class WhitespaceSeparatedListParser(BaseListParser):
method __init__ (line 2146) | def __init__(self):
method WriteCustomInfoInXMLFormat (line 2149) | def WriteCustomInfoInXMLFormat(self, outfile, indent):
function DEFINE_list (line 2157) | def DEFINE_list(name, default, help, flag_values=FLAGS, **args):
function DEFINE_spaceseplist (line 2164) | def DEFINE_spaceseplist(name, default, help, flag_values=FLAGS, **args):
class MultiFlag (line 2179) | class MultiFlag(Flag):
method __init__ (line 2196) | def __init__(self, *args, **kwargs):
method Parse (line 2200) | def Parse(self, arguments):
method Serialize (line 2229) | def Serialize(self):
method Type (line 2247) | def Type(self):
function DEFINE_multi (line 2251) | def DEFINE_multi(parser, serializer, name, default, help, flag_values=FL...
function DEFINE_multistring (line 2265) | def DEFINE_multistring(name, default, help, flag_values=FLAGS, **args):
function DEFINE_multi_int (line 2278) | def DEFINE_multi_int(name, default, help, lower_bound=None, upper_bound=...
FILE: src/Utils/base.h
function namespace (line 48) | namespace LinearDesign {
function namespace (line 104) | namespace Hash {
FILE: src/Utils/codon.h
function rtrim (line 21) | static inline void rtrim(std::string &s) {
function calc_cai (line 73) | float calc_cai(const std::string& rna_seq) const {
FILE: src/Utils/common.h
type class (line 33) | enum class
function Beam_type (line 50) | enum class Beam_type : std::uint8_t {
FILE: src/Utils/constants.h
function namespace (line 6) | namespace LinearDesign {
FILE: src/Utils/flat.h
function namespace (line 9) | namespace detail {
function LINEAR_DESIGN_INLINE (line 29) | LINEAR_DESIGN_INLINE iterator begin() {
function LINEAR_DESIGN_INLINE (line 33) | LINEAR_DESIGN_INLINE iterator end() {
function LINEAR_DESIGN_INLINE (line 41) | LINEAR_DESIGN_INLINE void reserve(const size_t n) {
function LINEAR_DESIGN_INLINE (line 45) | LINEAR_DESIGN_INLINE void resize(const size_t n) {
function reference (line 50) | reference operator[](size_t index) {
function const_reference (line 55) | const_reference operator[](size_t index) const {
function LINEAR_DESIGN_INLINE (line 59) | LINEAR_DESIGN_INLINE reference operator[](key_type key) {
function LINEAR_DESIGN_INLINE (line 63) | LINEAR_DESIGN_INLINE const_reference operator[](key_type key) const {
FILE: src/Utils/network.h
function namespace (line 26) | namespace LinearDesign {
function add_node (line 74) | void add_node(NodeType n1){
FILE: src/Utils/reader.h
type Reader (line 13) | struct Reader {
function Reader (line 19) | struct Fasta : public Reader {
FILE: src/backtrace_iter.cc
type LinearDesign (line 8) | namespace LinearDesign {
function BacktraceResult (line 11) | BacktraceResult BeamCKYParser<ScoreType, IndexType, NodeType>::backtra...
FILE: src/beam_cky_parser.cc
type LinearDesign (line 28) | namespace LinearDesign {
FILE: src/beam_cky_parser.h
function namespace (line 18) | namespace LinearDesign {
type NodeIndex (line 35) | struct NodeIndex {
type NodeNucReverseIndex2 (line 41) | struct NodeNucReverseIndex2 {
function update_if_better (line 200) | void update_if_better(State_t &state, const ScoreType newscore, const do...
function update_if_better (line 207) | void update_if_better(State_t &state, const ScoreType newscore, const do...
FILE: src/linear_design.cpp
function output_result (line 19) | bool output_result(const DecoderResult<ScoreType, IndexType>& result,
function show_usage (line 38) | void show_usage() {
function main (line 45) | int main(int argc, char** argv) {
Condensed preview — 22 files, each showing path, character count, and a content snippet. Download the .json file or copy for the full structured content (273K chars).
[
{
"path": ".gitattributes",
"chars": 53,
"preview": "*.cpp linguist-language=c++\n*.h linguist-language=c++"
},
{
"path": "Makefile",
"chars": 2221,
"preview": "\nCLA=clang++\nCXX=g++\nCXXFLAGS=-std=c++11 -Ofast -DFINAL_CHECK -DSPECIAL_HP -fpermissive\nDEPS=src/beam_cky_parser.cc src/"
},
{
"path": "README.md",
"chars": 3501,
"preview": "<img src=\"/pic/baidu_research_logo.jpg\" width=\"40%\" alt=\"Baidu Research Logo\">\n\n# Algorithm for Optimized mRNA Design "
},
{
"path": "coding_wheel.txt",
"chars": 274,
"preview": "Phe\tU U CU\nLeu\tC U GCUA\tU U GA\t\nSer\tU C GCUA\tA G CU\nTyr\tU A CU\nSTOP\tU A GA\tU G A\nCys\tU G CU\nTrp\tU G G\nPro\tC C GCUA\nHis\tC"
},
{
"path": "codon_usage_freq_table_human.csv",
"chars": 763,
"preview": "#,,\r\nUAA,*,0.28\r\nUAG,*,0.2\r\nUGA,*,0.52\r\nGCU,A,0.26\r\nGCC,A,0.4\r\nGCA,A,0.23\r\nGCG,A,0.11\r\nUGU,C,0.45\r\nUGC,C,0.55\r\nGAU,D,0."
},
{
"path": "codon_usage_freq_table_yeast.csv",
"chars": 766,
"preview": "#,,\r\nUAA,*,0.48\r\nUAG,*,0.24\r\nUGA,*,0.29\r\nGCU,A,0.38\r\nGCC,A,0.22\r\nGCA,A,0.29\r\nGCG,A,0.11\r\nUGU,C,0.63\r\nUGC,C,0.37\r\nGAU,D,"
},
{
"path": "gflags.py",
"chars": 83541,
"preview": "#!/usr/bin/env python\n\n# Copyright (c) 2007, Google Inc.\n# All rights reserved.\n#\n# Redistribution and use in source and"
},
{
"path": "license.txt",
"chars": 491,
"preview": "The LinearDesign code is freely accessible to all interested parties. \nIt is free for academic, non-profit, and research"
},
{
"path": "lineardesign",
"chars": 804,
"preview": "#!/usr/bin/env python2\n\nimport gflags as flags\nimport subprocess\nimport sys\nimport os\n\nFLAGS = flags.FLAGS\n\ndef setgflag"
},
{
"path": "src/Utils/base.h",
"chars": 4052,
"preview": "#ifndef base_h\n#define base_h\n\n#include <type_traits>\n#include <utility>\n#include <memory>\n#include <string>\n#include <v"
},
{
"path": "src/Utils/codon.h",
"chars": 5211,
"preview": "#ifndef codon_h\n#define codon_h\n\n#include <exception>\n#include <fstream>\n#include <string>\n#include <utility>\n#include <"
},
{
"path": "src/Utils/common.h",
"chars": 2570,
"preview": "#ifndef common_h\n#define common_h\n\n#include <utility>\n#include <functional>\n#include <array>\n#include <string>\n#include "
},
{
"path": "src/Utils/constants.h",
"chars": 1058,
"preview": "#ifndef constants_h\n#define constants_h\n\n#include <map>\n\nnamespace LinearDesign {\n\nconstexpr uint8_t k_void_nuc = 127;\n\n"
},
{
"path": "src/Utils/flat.h",
"chars": 1771,
"preview": "#ifndef flat_h\n#define flat_h\n\n#include <type_traits>\n#include <vector>\n\n#include \"base.h\"\n\nnamespace detail {\n templ"
},
{
"path": "src/Utils/network.h",
"chars": 24134,
"preview": "\n#include <map>\n#include <unordered_map>\n#include <vector>\n#include <fstream>\n#include <string>\n#include <sstream>\n#incl"
},
{
"path": "src/Utils/reader.h",
"chars": 1219,
"preview": "#ifndef fasta_h\n#define fasta_h\n\n#include <exception>\n#include <map>\n#include <fstream>\n#include <string>\n\n#include \"bas"
},
{
"path": "src/Utils/utility_v.h",
"chars": 2035,
"preview": "\n#ifndef FASTCKY_UTILITY_V_H\n#define FASTCKY_UTILITY_V_H\n\n#include <string>\n#include <vector>\n#include <cmath>\n#include "
},
{
"path": "src/backtrace_iter.cc",
"chars": 54129,
"preview": "\n#include \"beam_cky_parser.h\"\n\nusing namespace std;\n\n#define tetra_hex_tri -1\n\nnamespace LinearDesign {\n\ntemplate <typen"
},
{
"path": "src/beam_cky_parser.cc",
"chars": 60546,
"preview": "\n#include <fstream>\n#include <iostream>\n#include <sys/time.h>\n#include <stack>\n#include <tuple>\n#include <cassert>\n#incl"
},
{
"path": "src/beam_cky_parser.h",
"chars": 10177,
"preview": "\n#pragma once\n\n#include <memory>\n#include <string>\n#include <cstring>\n#include <limits>\n#include <vector>\n#include <unor"
},
{
"path": "src/linear_design.cpp",
"chars": 4633,
"preview": "#include <iomanip>\n#include \"beam_cky_parser.h\"\n#include \"beam_cky_parser.cc\"\n#include \"Utils/reader.h\"\n#include \"Utils/"
},
{
"path": "testseq",
"chars": 39,
"preview": ">seq1\nMPNTLACP\n>seq2\nMLDQVNKLKYPEVSLT*\n"
}
]
About this extraction
This page contains the full source code of the LinearDesignSoftware/LinearDesign GitHub repository, extracted and formatted as plain text for AI agents and large language models (LLMs). The extraction includes 22 files (257.8 KB), approximately 64.3k tokens, and a symbol index with 170 extracted functions, classes, methods, constants, and types. Use this with OpenClaw, Claude, ChatGPT, Cursor, Windsurf, or any other AI tool that accepts text input. You can copy the full output to your clipboard or download it as a .txt file.
Extracted by GitExtract — free GitHub repo to text converter for AI. Built by Nikandr Surkov.