Showing preview only (4,986K chars total). Download the full file or copy to clipboard to get everything.
Repository: cole-trapnell-lab/cufflinks
Branch: master
Commit: dc3b0cb72a4a
Files: 235
Total size: 4.7 MB
Directory structure:
gitextract_l5aioowe/
├── .gitignore
├── AUTHORS
├── LICENSE
├── Makefile.am
├── README.md
├── autogen.sh
├── ax_bam.m4
├── ax_boost_base.m4
├── ax_boost_filesystem.m4
├── ax_boost_serialization.m4
├── ax_boost_system.m4
├── ax_boost_thread.m4
├── ax_check_eigen.m4
├── ax_check_zlib.m4
├── ax_openmp.m4
├── boost.m4
├── configure.ac
├── cufflinks.xcodeproj/
│ ├── cole.pbxuser
│ ├── cole.perspectivev3
│ └── project.pbxproj
├── doc/
│ ├── CL_figure_scratch.doc
│ ├── CL_main_text.doc
│ ├── CL_supplement.tex
│ ├── CL_versions.tex
│ ├── Cartoons.pptx
│ ├── Paper Outline.doc
│ ├── algorithm/
│ │ ├── algorithm.bib
│ │ ├── algorithm.tex
│ │ └── homework.cls
│ ├── cufflinks.bib
│ ├── html/
│ │ ├── css/
│ │ │ └── style.css
│ │ ├── downloads/
│ │ │ └── test_data.sam
│ │ ├── faq.html
│ │ ├── gff.html
│ │ ├── howitworks.html
│ │ ├── igenome/
│ │ │ └── igenome_table.py
│ │ ├── igenomes.html
│ │ ├── images/
│ │ │ └── ucsc-track.tiff
│ │ ├── index.html
│ │ ├── manual.html
│ │ ├── site.tmproj
│ │ └── tutorial.html
│ └── illustrator/
│ └── Fig 2 - Tuxedo Workflow.ai
├── external_tests/
│ └── tiny_tests/
│ └── 2x75/
│ ├── accepted_hits.sam
│ └── test_ref.fa
├── index.md
├── make_bin.sh
├── src/
│ ├── GArgs.cpp
│ ├── GArgs.h
│ ├── GBase.cpp
│ ├── GBase.h
│ ├── GFaSeqGet.cpp
│ ├── GFaSeqGet.h
│ ├── GFastaIndex.cpp
│ ├── GFastaIndex.h
│ ├── GHash.hh
│ ├── GList.hh
│ ├── GStr.cpp
│ ├── GStr.h
│ ├── GVec.hh
│ ├── LICENSE
│ ├── Makefile.am
│ ├── abundances.cpp
│ ├── abundances.h
│ ├── assemble.cpp
│ ├── assemble.h
│ ├── biascorrection.cpp
│ ├── biascorrection.h
│ ├── bundles.cpp
│ ├── bundles.h
│ ├── clustering.cpp
│ ├── clustering.h
│ ├── codons.cpp
│ ├── codons.h
│ ├── common.cpp
│ ├── common.h
│ ├── compress_gtf.cpp
│ ├── cuffcluster.cpp
│ ├── cuffcompare.cpp
│ ├── cuffdiff.cpp
│ ├── cuffdiff_to_gct.py
│ ├── cufflinks.cpp
│ ├── cufflinks.xcodeproj/
│ │ ├── cole.pbxuser
│ │ ├── cole.perspectivev3
│ │ └── project.pbxproj
│ ├── cuffmerge
│ ├── cuffnorm.cpp
│ ├── cuffquant.cpp
│ ├── differential.cpp
│ ├── differential.h
│ ├── filters.cpp
│ ├── filters.h
│ ├── gdna.cpp
│ ├── gdna.h
│ ├── genes.cpp
│ ├── genes.h
│ ├── gff.cpp
│ ├── gff.h
│ ├── gff_utils.cpp
│ ├── gff_utils.h
│ ├── gffread.cpp
│ ├── graph_optimize.cpp
│ ├── graph_optimize.h
│ ├── gtf_reads.cpp
│ ├── gtf_to_sam.cpp
│ ├── gtf_tracking.cpp
│ ├── gtf_tracking.h
│ ├── hits.cpp
│ ├── hits.h
│ ├── jensen_shannon.cpp
│ ├── jensen_shannon.h
│ ├── lemon/
│ │ ├── bfs.h
│ │ ├── bin_heap.h
│ │ ├── bipartite_matching.h
│ │ ├── bits/
│ │ │ ├── alteration_notifier.h
│ │ │ ├── array_map.h
│ │ │ ├── base_extender.h
│ │ │ ├── debug_map.h
│ │ │ ├── default_map.h
│ │ │ ├── graph_adaptor_extender.h
│ │ │ ├── graph_extender.h
│ │ │ ├── invalid.h
│ │ │ ├── map_extender.h
│ │ │ ├── path_dump.h
│ │ │ ├── traits.h
│ │ │ ├── utility.h
│ │ │ ├── variant.h
│ │ │ └── vector_map.h
│ │ ├── bucket_heap.h
│ │ ├── concept_check.h
│ │ ├── concepts/
│ │ │ ├── bpugraph.h
│ │ │ ├── graph.h
│ │ │ ├── graph_components.h
│ │ │ ├── heap.h
│ │ │ ├── maps.h
│ │ │ ├── matrix_maps.h
│ │ │ ├── path.h
│ │ │ └── ugraph.h
│ │ ├── dfs.h
│ │ ├── error.h
│ │ ├── fib_heap.h
│ │ ├── graph_adaptor.h
│ │ ├── graph_utils.h
│ │ ├── list_graph.h
│ │ ├── maps.h
│ │ ├── math.h
│ │ ├── smart_graph.h
│ │ ├── tolerance.h
│ │ └── topology.h
│ ├── locfit/
│ │ ├── adap.c
│ │ ├── ar_funs.c
│ │ ├── arith.c
│ │ ├── band.c
│ │ ├── c_args.c
│ │ ├── c_plot.c
│ │ ├── cmd.c
│ │ ├── dens_haz.c
│ │ ├── dens_int.c
│ │ ├── dens_odi.c
│ │ ├── density.c
│ │ ├── design.h
│ │ ├── dist.c
│ │ ├── ev_atree.c
│ │ ├── ev_interp.c
│ │ ├── ev_kdtre.c
│ │ ├── ev_main.c
│ │ ├── ev_trian.c
│ │ ├── family.c
│ │ ├── fitted.c
│ │ ├── frend.c
│ │ ├── help.c
│ │ ├── imatlb.h
│ │ ├── lf_dercor.c
│ │ ├── lf_fitfun.c
│ │ ├── lf_robust.c
│ │ ├── lf_vari.c
│ │ ├── lfcons.h
│ │ ├── lfd.c
│ │ ├── lffuns.h
│ │ ├── lfstr.c
│ │ ├── lfstruc.h
│ │ ├── lfwin.h
│ │ ├── linalg.c
│ │ ├── local.h
│ │ ├── locfit.c
│ │ ├── m_chol.c
│ │ ├── m_eigen.c
│ │ ├── m_jacob.c
│ │ ├── m_max.c
│ │ ├── makecmd.c
│ │ ├── math.c
│ │ ├── minmax.c
│ │ ├── mutil.h
│ │ ├── nbhd.c
│ │ ├── pcomp.c
│ │ ├── pout.c
│ │ ├── preplot.c
│ │ ├── random.c
│ │ ├── readfile.c
│ │ ├── scb.c
│ │ ├── scb_cons.c
│ │ ├── simul.c
│ │ ├── solve.c
│ │ ├── startlf.c
│ │ ├── strings.c
│ │ ├── vari.cpp
│ │ ├── vari.hpp
│ │ ├── wdiag.c
│ │ └── weight.c
│ ├── matching_merge.cpp
│ ├── matching_merge.h
│ ├── multireads.cpp
│ ├── multireads.h
│ ├── negative_binomial_distribution.h
│ ├── progressbar.h
│ ├── replicates.cpp
│ ├── replicates.h
│ ├── rounding.h
│ ├── sampling.cpp
│ ├── sampling.h
│ ├── scaffold_graph.cpp
│ ├── scaffold_graph.h
│ ├── scaffolds.cpp
│ ├── scaffolds.h
│ ├── tokenize.cpp
│ ├── tokenize.h
│ ├── tracking.cpp
│ ├── tracking.h
│ ├── transitive_closure.h
│ ├── transitive_reduction.h
│ └── update_check.h
├── tests/
│ └── unit_tests/
│ ├── test_abundances.cpp
│ ├── test_main.cpp
│ └── test_scaffolds.cpp
└── version.m4
================================================
FILE CONTENTS
================================================
================================================
FILE: .gitignore
================================================
*.o
Makefile
Makefile.in
aclocal.m4
autom4te.cache
build-aux
config.h
config.h.in
config.log
config.status
configure
.deps
Makefile.in
compress_gtf
cuffcompare
cuffdiff
cufflinks
cuffnorm
cuffquant
gffread
gtf_to_sam
*.a
stamp-h1
================================================
FILE: AUTHORS
================================================
Cufflinks authors
Primary contact <cole@cs.umd.edu>
Cole Trapnell designed and wrote Cufflinks and Cuffdiff, with substantial technical input
from Geo Pertea, Brian Williams, Ali Mortazavi, Jeltje van Baren, Steven Salzberg, Barbara Wold,
and Lior Pachter. Geo Pertea wrote Cuffcompare. Adam Roberts made substantial improvements to
the abundance estimation model used by Cufflinks and Cuffdiff.
"Tuxedo" Websites:
Cufflinks: http://cole-trapnell-lab.github.io/cufflinks/
TopHat: http://tophat.cbcb.umd.edu
Bowtie: http://bowtie-bio.sf.net
As of version 1.0, Cufflinks depends on and includes LOCFIT, a regression package originally written
by Catherine Loader and Jiayang Sun. Some modifications were made to LOCFIT. Modified source
for LOCFIT lives in src/locfit.
================================================
FILE: LICENSE
================================================
Copyright (C) 2003-2009 Cole Trapnell et al
===========================================================================
Boost Software License, Version 1.0
===========================================================================
Permission is hereby granted, free of charge, to any person or organization
obtaining a copy of the software and accompanying documentation covered by
this license (the "Software") to use, reproduce, display, distribute,
execute, and transmit the Software, and to prepare derivative works of the
Software, and to permit third-parties to whom the Software is furnished to
do so, all subject to the following:
The copyright notices in the Software and this entire statement, including
the above license grant, this restriction and the following disclaimer,
must be included in all copies of the Software, in whole or in part, and
all derivative works of the Software, unless such copies or derivative
works are solely in the form of machine-executable object code generated by
a source language processor.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE, TITLE AND NON-INFRINGEMENT. IN NO EVENT
SHALL THE COPYRIGHT HOLDERS OR ANYONE DISTRIBUTING THE SOFTWARE BE LIABLE
FOR ANY DAMAGES OR OTHER LIABILITY, WHETHER IN CONTRACT, TORT OR OTHERWISE,
ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
DEALINGS IN THE SOFTWARE.
================================================
FILE: Makefile.am
================================================
ALWAYS_BUILT = src
SUBDIRS = $(ALWAYS_BUILT)
DIST_SUBDIRS = $(ALWAYS_BUILT)
EXTRA_DIST = LICENSE
.PHONY: FORCE
================================================
FILE: README.md
================================================
# Cufflinks
The main *website* for cufflinks is [here](http://cole-trapnell-lab.github.io/cufflinks/)
*NOTE*: If you're looking for old releases of Cufflinks, including source, you can find them [here](http://cole-trapnell-lab.github.io/cufflinks/install/).
Cufflinks assembles transcripts, estimates their abundances, and tests for differential expression and regulation in RNA-Seq samples. It accepts aligned RNA-Seq reads and assembles the alignments into a parsimonious set of transcripts. Cufflinks then estimates the relative abundances of these transcripts based on how many reads support each one, taking into account biases in library preparation protocols.
Cufflinks was originally developed as part of a collaborative effort between the [Laboratory for Mathematical and Computational Biology](http://bio.math.berkeley.edu/), led by Lior Pachter at UC Berkeley, Steven Salzberg's [computational genomics group](http://ccb.jhu.edu/people/salzberg/) at the Institute of Genetic Medicine at Johns Hopkins University, and [Barbara Wold's lab](http://woldlab.caltech.edu/) at Caltech. The project is now maintained by [Cole Trapnell's](http://cole-trapnell-lab.github.io/) lab at the University of Washington.
Cufflinks is provided under the OSI-approved [Boost License](http://en.wikipedia.org/wiki/Boost_Software_License)
# News
*To get the latest updates on the Cufflinks project and the rest of the "Tuxedo tools", please subscribe to our [**mailing list**](https://lists.sourceforge.net/lists/listinfo/bowtie-bio-announce)*
# Install quick-start
## Installing a pre-compiled binary release
In order to make it easy to install Cufflinks, we provide a few binary packages [here](http://cole-trapnell-lab.github.io/cufflinks/install/) to save users from the occasionally frustrating process of building Cufflinks, which requires that you install the Boost libraries. To use the binary packages, simply download the appropriate one for your machine, untar it, and make sure the cufflinks,cuffdiff and cuffcompare binaries are in a directory in your PATH environment variable.
# Building Cufflinks from source
In order to build Cufflinks, you must have the [Boost C++ libraries](http://www.boost.org/) (version 1.47 or higher) installed on your system. See below for instructions on installing Boost.
## Installing Boost
1. Download Boost and the bjam build engine. **WARNING:** Due to a serious issue with Boost Serlialization library introduced in version 1.56, Cufflinks currently can only be built with Boost version 1.55 or lower. The issue is expected to be fixed in the upcoming Boost v1.59.
2. Unpack bjam and add it to your PATH.
3. Unpack the Boost tarball and cd to the Boost source directory. This directory is called the BOOST_ROOT in some Boost installation instructions.
4. Build Boost. Note that you can specify where to put Boost with the --prefix option. The default Boost installation directory is /usr/local. Take note of the boost installation directory, because you will need to tell the Cufflinks installer where to find Boost later on.
- If you are on Mac OS X, type (all on one line):
```bash
bjam --prefix=<YOUR_BOOST_INSTALL_DIRECTORY> --toolset=darwin architecture=x86 address_model=32_64 link=static runtime-link=static --layout=versioned stage install
```
- If you are on a 32-bit Linux system, type (all on one line):
```bash
bjam --prefix=<YOUR_BOOST_INSTALL_DIRECTORY> --toolset=gcc architecture=x86 address_model=32 link=static runtime-link=static stage install
```
- If you are on a 64-bit Linux system, type (all on one line):
```bash
bjam --prefix=<YOUR_BOOST_INSTALL_DIRECTORY> --toolset=gcc architecture=x86 address_model=64 link=static runtime-link=static stage install
```
## Installing the SAM tools
1. [Download the SAM tools](http://samtools.sourceforge.net/)
2. Unpack the SAM tools tarball and cd to the SAM tools source directory.
3. Build the SAM tools by typing make at the command line.
4. Choose a directory into which you wish to copy the SAM tools binary, the included library <tt>libbam.a</tt>, and the library headers. A common choice is <tt>/usr/local/</tt>.
5. Copy libbam.a to the lib/ directory in the folder you've chosen above (e.g. <tt>/usr/local/lib/</tt>)
6. Create a directory called "bam" in the <tt>include/</tt> directory (e.g. <tt>/usr/local/include/bam</tt>)
7. Copy the headers (files ending in <tt>.h</tt>) to the include/bam directory you've created above (e.g. <tt>/usr/local/include/</tt>bam)
8. Copy the samtools binary to some directory in your <tt>PATH</tt>.
## Installing the Eigen libraries
1. [Download Eigen](http://eigen.tuxfamily.org/)
2. Unpack the Eigen tarball and cd to the Eigen source directory.
3. Copy the Eigen/ subdirectory someplace on your system where you keep header files (e.g. /usr/local/include)
## Building Cufflinks
### If you are starting from a source tarball downloaded from [here](http://cole-trapnell-lab.github.io/cufflinks/install/):
Unpack the Cufflinks source tarball (in this example for version 2.2.1):
```bash
tar zxvf cufflinks-2.2.1.tar.gz
```
Change to the Cufflinks directory:
```bash
cd cufflinks-2.2.1
```
### If you want to clone the Cufflinks github repo:
```bash
git clone https://github.com/cole-trapnell-lab/cufflinks.git
cd cufflinks
autoreconf --install
```
The above will generate the configure script.
### To configure Cufflinks prior to the build
If Boost is installed somewhere other than /usr/local, you will need to tell the installer where to find it using the --with-boost option. Specify where to install Cufflinks using the --prefix option.
```bash
./configure --prefix=/path/to/cufflinks/install --with-boost=/path/to/boost --with-eigen=/path/to/eigen
```
If you see any errors during configuration, verify that you are using Boost version 1.47 or higher, and that the directory you specified via --with-boost contains the boost header files and libraries. See the Boost Getting started page for more details. If you copied the SAM tools binaries to someplace other than /usr/local/, you may need to supply the --with-bam configuration option.
Finally, make and install Cufflinks.
```bash
make
make install
```
## Testing the installation
1. [Download](http://cufflinks.cbcb.umd.edu/downloads/test_data.sam) the test data
2. In the directory where you placed the test file, type:
```bash
cufflinks ./test_data.sam
```
You should see the following output:
<pre>
[bam_header_read] EOF marker is absent. The input is probably truncated.
[bam_header_read] invalid BAM binary header (this is not a BAM file).
File ./test_data.sam doesn't appear to be a valid BAM file, trying SAM...
[13:23:15] Inspecting reads and determining fragment length distribution.
> Processed 1 loci. [*************************] 100%
Warning: Using default Gaussian distribution due to insufficient paired-end reads in open ranges.
It is recommended that correct paramaters (--frag-len-mean and --frag-len-std-dev) be provided.
> Map Properties:
> Total Map Mass: 102.50
> Read Type: 75bp x 75bp
> Fragment Length Distribution: Truncated Gaussian (default)
> Estimated Mean: 200
> Estimated Std Dev: 80
[13:23:15] Assembling transcripts and estimating abundances.
> Processed 1 loci. [*************************] 100%
</pre>
Verify that the file transcripts.gtf is in the current directory and looks like this (your file will have GTF attributes, omitted here for clarity)
<pre>
test_chromosome Cufflinks exon 53 250 1000 + .
test_chromosome Cufflinks exon 351 400 1000 + .
test_chromosome Cufflinks exon 501 550 1000 + .
</pre>
# Common uses of the Cufflinks package
Cufflinks includes a number of tools for analyzing RNA-Seq experiments. Some of these tools can be run on their own, while others are pieces of a larger workflow. The complexity of your workflow depends on what you want to achieve with your analysis. For a complete discussion of how Cufflinks can help you with your analysis, please [see our protocol paper](http://www.nature.com/nprot/journal/v7/n3/full/nprot.2012.016.html). The paper includes a diagram (Figure 2) describing how the various parts of the Cufflinks package (and its companion tool TopHat) fit together. As of version 2.2.0, you can also run Cuffquant and Cuffnorm to make large scale analyses easier to handle. The figure below is an updated version of Figure 2 showing how the two utilities released after the protocol paper appeared fit into the workflow:
<div style="text-align:center">

</div>
You can use Cuffquant to pre-compute gene expression levels for each of your samples, which can save time if you have to re-run part of your analysis. Using Cuffquant also makes it easier to spread the load of computation for lots of samples across multiple computers. If you don't want to perform differential expression analysis, you can run Cuffnorm instead of Cuffdiff. Cuffnorm produces simple tables of expression values that you can look at in R (for example) to cluster samples and perform other follow up analysis.
# Using pre-built annotation packages
A number of steps in the Tuxedo package work better if you have pre-existing gene annotations. How you can use these annotations is detailed in our [protocol paper](http://www.nature.com/nprot/journal/v7/n3/full/nprot.2012.016.html). Illumina has kindly provided a large number of annotation packages for commonly used model organisms and humans. You can find these packages [here]({{ site.url }}/igenome_table/index.html).
# References
Cufflinks is an ongoing research project as well as a suite of tools. Here are the papers that describe the science behind the programs. If you use Cufflinks, please cite these papers in your work!
**Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation**
Cole Trapnell, Brian Williams, Geo Pertea, Ali Mortazavi, Gordon Kwan, Jeltje van Baren, Steven Salzberg, Barbara Wold, Lior Pachter.
*Nature Biotechnology*, 2010, doi:10.1038/nbt.1621
*Note: This is the original Cufflinks paper. Please cite this paper if you use Cufflinks in your work.*
**Improving RNA-Seq expression estimates by correcting for fragment bias**
Adam Roberts, Cole Trapnell, Julie Donaghey, John L. Rinn, Lior Pachter.
*Genome Biology*, 2011, doi:10.1186/gb-2011-12-3-r22
*Note: This paper describes improvements made to Cufflinks to handle bias in RNA-Seq read coverage. Please cite this paper if you use Cufflinks with the <tt>-b</tt> option in your work.*
**Identification of novel transcripts in annotated genomes using RNA-Seq**
Adam Roberts, Harold Pimentel, Cole Trapnell, Lior Pachter.
*Bioinformatics*, 2011, doi:10.1093/bioinformatics/btr355
*Note: This paper describes the RABT assembly algorithm. Please cite this paper if you use Cufflinks in RABT mode in your work.*
**Differential analysis of gene regulation at transcript resolution with RNA-seq**
Cole Trapnell, David Hendrickson, Martin Sauvageau, Loyal Goff, John L. Rinn, Lior Pachter
*Nature Biotechnology*, 2012, doi:10.1038/nbt.2450
*Note: This paper describes Cuffdiff 2. Please cite this paper if you use Cuffdiff in your work.*
Cufflinks builds on many ideas, including some
proposed in the following papers:
1. Ali Mortazavi, Brian A Williams, Kenneth McCue, Lorian Schaeffer and Barbara
Wold, "Mapping and quantifying mammalian transcriptomes by RNA-Seq",Nature
Methods, volume 5, 621 - 628 (2008)
2. Hui Jiang and Wing Hung Wong, "Statistical Inferences for isoform expression",
Bioinformatics, 2009 25(8):1026-1032=
3.Nicholas Eriksson, Lior Pachter, Yumi Mitsuya, Soo-Yon Rhee, Chunlin Wang,
Baback Gharizadeh, Mostafa Ronaghi, Robert W. Shafer, Niko Beerenwinkel, "Viral
population estimation using pyrosequencing", PLoS Computational Biology,
4(5):e1000074
================================================
FILE: autogen.sh
================================================
#!/bin/sh
submodule_init ( ) {
local SUBMODULES=$(git submodule | awk '{print $2}')
for submodule in $SUBMODULES; do
echo "Initializing submodule $submodule"
git submodule init $submodule
git submodule update $submodule
cd $submodule
if test -f version.sh
then
./version.sh
fi
submodule_init
cd ..
done
}
./version.sh
submodule_init
autoreconf --install
================================================
FILE: ax_bam.m4
================================================
# SYNOPSIS
#
# AX_BAM
#
# DESCRIPTION
#
# Test for the BAM libraries (htslib or bamlib)
#
# If no path to the installed bam library is given the macro searchs
# under /usr, /usr/local, /opt and /opt/local and evaluates the
# $BAM_ROOT environment variable.
# Adapted from AX_BOOST_BASE
#
# This macro calls:
#
# AC_SUBST(BAM_CPPFLAGS) / AC_SUBST(BAM_LDFLAGS)
#
# And sets:
#
# HAVE_BAM, HAVE_HTSLIB
#
# LICENSE
#
# Copyright (c) 2010 Cole Trapnell <cole@cs.umd.edu>
#
# Copying and distribution of this file, with or without modification, are
# permitted in any medium without royalty provided the copyright notice
# and this notice are preserved.
AC_DEFUN([AX_BAM],
[
AC_ARG_WITH([bam],
AS_HELP_STRING([--with-bam@<:@=DIR@:>@], [use BAM libraries (default is yes) - it is possible to specify the root directory for BAM (optional)]),
[
if test "$withval" = "no"; then
want_bam="no"
elif test "$withval" = "yes"; then
want_bam="yes"
ac_bam_path=""
else
want_bam="yes"
ac_bam_path="$withval"
fi
],
[want_bam="yes"])
AC_ARG_WITH([bam-libdir],
AS_HELP_STRING([--with-bam-libdir=LIB_DIR],
[Force given directory for bam libraries. Note that this will overwrite library path detection, so use this parameter only if default library detection fails and you know exactly where your bam libraries are located.]),
[
if test -d $withval
then
ac_bam_lib_path="$withval"
else
AC_MSG_ERROR(--with-bam-libdir expected directory name)
fi
],
[ac_bam_lib_path=""]
)
if test "x$want_bam" = "xyes"; then
# bam_lib_version_req=ifelse([$1], ,1.20.0,$1)
# bam_lib_version_req_shorten=`expr $bam_lib_version_req : '\([[0-9]]*\.[[0-9]]*\)'`
# bam_lib_version_req_major=`expr $bam_lib_version_req : '\([[0-9]]*\)'`
# bam_lib_version_req_minor=`expr $bam_lib_version_req : '[[0-9]]*\.\([[0-9]]*\)'`
# bam_lib_version_req_sub_minor=`expr $bam_lib_version_req : '[[0-9]]*\.[[0-9]]*\.\([[0-9]]*\)'`
# if test "x$bam_lib_version_req_sub_minor" = "x" ; then
# bam_lib_version_req_sub_minor="0"
# fi
# WANT_BAM_VERSION=`expr $bam_lib_version_req_major \* 100000 \+ $bam_lib_version_req_minor \* 100 \+ $bam_lib_version_req_sub_minor`
AC_MSG_CHECKING(for htslib or bamlib)
succeeded=no
USE_HTSLIB=0
dnl first we check the system location for bam libraries
SEARCH_DIRS="/usr /usr/local /opt /opt/local"
if test "$ac_bam_path" != ""; then
SEARCH_DIRS=$ac_bam_path
fi
for ac_bam_path_tmp in $SEARCH_DIRS ; do
if test -d "$ac_bam_path_tmp/include/htslib" && test -r "$ac_bam_path_tmp/include/htslib"; then
BAM_LDFLAGS="-L$ac_bam_path_tmp/lib"
BAM_CPPFLAGS="-I$ac_bam_path_tmp/include"
BAM_LIB_PARAM="-lhts"
USE_HTSLIB=1
AC_DEFINE(HAVE_HTSLIB,,[define if the BAM library is htslib])
break;
fi
if test -d "$ac_bam_path_tmp/include/bam" && test -r "$ac_bam_path_tmp/include/bam"; then
BAM_LDFLAGS="-L$ac_bam_path_tmp/lib"
BAM_CPPFLAGS="-I$ac_bam_path_tmp/include"
BAM_LIB_PARAM="-lbam"
break;
fi
done
dnl overwrite ld flags if we have required special directory with
dnl --with-bam-libdir parameter
if test "$ac_bam_lib_path" != ""; then
BAM_LDFLAGS="-L$ac_bam_lib_path"
fi
CPPFLAGS_SAVED="$CPPFLAGS"
CPPFLAGS="$CPPFLAGS $BAM_CPPFLAGS"
export CPPFLAGS
LDFLAGS_SAVED="$LDFLAGS"
LDFLAGS="$LDFLAGS $BAM_LDFLAGS"
export LDFLAGS
if test "$USE_HTSLIB" == "0"; then
AC_LANG_PUSH(C++)
AC_COMPILE_IFELSE([AC_LANG_PROGRAM([[
@%:@include <bam/bam.h>
]], [[]])],[
AC_MSG_RESULT(yes)
succeeded=yes
found_system=yes
],[
])
AC_LANG_POP([C++])
else
AC_LANG_PUSH(C++)
AC_COMPILE_IFELSE([AC_LANG_PROGRAM([[
@%:@include <htslib/hts.h>
]], [[]])],[
AC_MSG_RESULT(yes)
succeeded=yes
found_system=yes
],[
])
AC_LANG_POP([C++])
fi
if test "$succeeded" != "yes" ; then
AC_MSG_ERROR([[We could not detect the bam libraries. Try installing htslib or libbam, or specifying a path to one with --with-bam=/some/path]])
else
BAM_LIB="$BAM_LIB_PARAM"
AC_SUBST(BAM_CPPFLAGS)
AC_SUBST(BAM_LDFLAGS)
AC_SUBST(BAM_LIB)
AC_DEFINE(HAVE_BAM,,[define if the BAM library is available])
fi
CPPFLAGS="$CPPFLAGS_SAVED"
LDFLAGS="$LDFLAGS_SAVED"
fi
])
================================================
FILE: ax_boost_base.m4
================================================
# ===========================================================================
# https://www.gnu.org/software/autoconf-archive/ax_boost_base.html
# ===========================================================================
#
# SYNOPSIS
#
# AX_BOOST_BASE([MINIMUM-VERSION], [ACTION-IF-FOUND], [ACTION-IF-NOT-FOUND])
#
# DESCRIPTION
#
# Test for the Boost C++ libraries of a particular version (or newer)
#
# If no path to the installed boost library is given the macro searchs
# under /usr, /usr/local, /opt and /opt/local and evaluates the
# $BOOST_ROOT environment variable. Further documentation is available at
# <http://randspringer.de/boost/index.html>.
#
# This macro calls:
#
# AC_SUBST(BOOST_CPPFLAGS) / AC_SUBST(BOOST_LDFLAGS)
#
# And sets:
#
# HAVE_BOOST
#
# LICENSE
#
# Copyright (c) 2008 Thomas Porschberg <thomas@randspringer.de>
# Copyright (c) 2009 Peter Adolphs
#
# Copying and distribution of this file, with or without modification, are
# permitted in any medium without royalty provided the copyright notice
# and this notice are preserved. This file is offered as-is, without any
# warranty.
#serial 45
# example boost program (need to pass version)
m4_define([_AX_BOOST_BASE_PROGRAM],
[AC_LANG_PROGRAM([[
#include <boost/version.hpp>
]],[[
(void) ((void)sizeof(char[1 - 2*!!((BOOST_VERSION) < ($1))]));
]])])
AC_DEFUN([AX_BOOST_BASE],
[
AC_ARG_WITH([boost],
[AS_HELP_STRING([--with-boost@<:@=ARG@:>@],
[use Boost library from a standard location (ARG=yes),
from the specified location (ARG=<path>),
or disable it (ARG=no)
@<:@ARG=yes@:>@ ])],
[
AS_CASE([$withval],
[no],[want_boost="no";_AX_BOOST_BASE_boost_path=""],
[yes],[want_boost="yes";_AX_BOOST_BASE_boost_path=""],
[want_boost="yes";_AX_BOOST_BASE_boost_path="$withval"])
],
[want_boost="yes"])
AC_ARG_WITH([boost-libdir],
[AS_HELP_STRING([--with-boost-libdir=LIB_DIR],
[Force given directory for boost libraries.
Note that this will override library path detection,
so use this parameter only if default library detection fails
and you know exactly where your boost libraries are located.])],
[
AS_IF([test -d "$withval"],
[_AX_BOOST_BASE_boost_lib_path="$withval"],
[AC_MSG_ERROR([--with-boost-libdir expected directory name])])
],
[_AX_BOOST_BASE_boost_lib_path=""])
BOOST_LDFLAGS=""
BOOST_CPPFLAGS=""
AS_IF([test "x$want_boost" = "xyes"],
[_AX_BOOST_BASE_RUNDETECT([$1],[$2],[$3])])
AC_SUBST(BOOST_CPPFLAGS)
AC_SUBST(BOOST_LDFLAGS)
])
# convert a version string in $2 to numeric and affect to polymorphic var $1
AC_DEFUN([_AX_BOOST_BASE_TONUMERICVERSION],[
AS_IF([test "x$2" = "x"],[_AX_BOOST_BASE_TONUMERICVERSION_req="1.20.0"],[_AX_BOOST_BASE_TONUMERICVERSION_req="$2"])
_AX_BOOST_BASE_TONUMERICVERSION_req_shorten=`expr $_AX_BOOST_BASE_TONUMERICVERSION_req : '\([[0-9]]*\.[[0-9]]*\)'`
_AX_BOOST_BASE_TONUMERICVERSION_req_major=`expr $_AX_BOOST_BASE_TONUMERICVERSION_req : '\([[0-9]]*\)'`
AS_IF([test "x$_AX_BOOST_BASE_TONUMERICVERSION_req_major" = "x"],
[AC_MSG_ERROR([You should at least specify libboost major version])])
_AX_BOOST_BASE_TONUMERICVERSION_req_minor=`expr $_AX_BOOST_BASE_TONUMERICVERSION_req : '[[0-9]]*\.\([[0-9]]*\)'`
AS_IF([test "x$_AX_BOOST_BASE_TONUMERICVERSION_req_minor" = "x"],
[_AX_BOOST_BASE_TONUMERICVERSION_req_minor="0"])
_AX_BOOST_BASE_TONUMERICVERSION_req_sub_minor=`expr $_AX_BOOST_BASE_TONUMERICVERSION_req : '[[0-9]]*\.[[0-9]]*\.\([[0-9]]*\)'`
AS_IF([test "X$_AX_BOOST_BASE_TONUMERICVERSION_req_sub_minor" = "X"],
[_AX_BOOST_BASE_TONUMERICVERSION_req_sub_minor="0"])
_AX_BOOST_BASE_TONUMERICVERSION_RET=`expr $_AX_BOOST_BASE_TONUMERICVERSION_req_major \* 100000 \+ $_AX_BOOST_BASE_TONUMERICVERSION_req_minor \* 100 \+ $_AX_BOOST_BASE_TONUMERICVERSION_req_sub_minor`
AS_VAR_SET($1,$_AX_BOOST_BASE_TONUMERICVERSION_RET)
])
dnl Run the detection of boost should be run only if $want_boost
AC_DEFUN([_AX_BOOST_BASE_RUNDETECT],[
_AX_BOOST_BASE_TONUMERICVERSION(WANT_BOOST_VERSION,[$1])
succeeded=no
AC_REQUIRE([AC_CANONICAL_HOST])
dnl On 64-bit systems check for system libraries in both lib64 and lib.
dnl The former is specified by FHS, but e.g. Debian does not adhere to
dnl this (as it rises problems for generic multi-arch support).
dnl The last entry in the list is chosen by default when no libraries
dnl are found, e.g. when only header-only libraries are installed!
AS_CASE([${host_cpu}],
[x86_64],[libsubdirs="lib64 libx32 lib lib64"],
[ppc64|powerpc64|s390x|sparc64|aarch64|ppc64le|powerpc64le|riscv64],[libsubdirs="lib64 lib lib64"],
[libsubdirs="lib"]
)
dnl allow for real multi-arch paths e.g. /usr/lib/x86_64-linux-gnu. Give
dnl them priority over the other paths since, if libs are found there, they
dnl are almost assuredly the ones desired.
AS_CASE([${host_cpu}],
[i?86],[multiarch_libsubdir="lib/i386-${host_os}"],
[multiarch_libsubdir="lib/${host_cpu}-${host_os}"]
)
dnl first we check the system location for boost libraries
dnl this location ist chosen if boost libraries are installed with the --layout=system option
dnl or if you install boost with RPM
AS_IF([test "x$_AX_BOOST_BASE_boost_path" != "x"],[
AC_MSG_CHECKING([for boostlib >= $1 ($WANT_BOOST_VERSION) includes in "$_AX_BOOST_BASE_boost_path/include"])
AS_IF([test -d "$_AX_BOOST_BASE_boost_path/include" && test -r "$_AX_BOOST_BASE_boost_path/include"],[
AC_MSG_RESULT([yes])
BOOST_CPPFLAGS="-I$_AX_BOOST_BASE_boost_path/include"
for _AX_BOOST_BASE_boost_path_tmp in $multiarch_libsubdir $libsubdirs; do
AC_MSG_CHECKING([for boostlib >= $1 ($WANT_BOOST_VERSION) lib path in "$_AX_BOOST_BASE_boost_path/$_AX_BOOST_BASE_boost_path_tmp"])
AS_IF([test -d "$_AX_BOOST_BASE_boost_path/$_AX_BOOST_BASE_boost_path_tmp" && test -r "$_AX_BOOST_BASE_boost_path/$_AX_BOOST_BASE_boost_path_tmp" ],[
AC_MSG_RESULT([yes])
BOOST_LDFLAGS="-L$_AX_BOOST_BASE_boost_path/$_AX_BOOST_BASE_boost_path_tmp";
break;
],
[AC_MSG_RESULT([no])])
done],[
AC_MSG_RESULT([no])])
],[
if test X"$cross_compiling" = Xyes; then
search_libsubdirs=$multiarch_libsubdir
else
search_libsubdirs="$multiarch_libsubdir $libsubdirs"
fi
for _AX_BOOST_BASE_boost_path_tmp in /usr /usr/local /opt /opt/local ; do
if test -d "$_AX_BOOST_BASE_boost_path_tmp/include/boost" && test -r "$_AX_BOOST_BASE_boost_path_tmp/include/boost" ; then
for libsubdir in $search_libsubdirs ; do
if ls "$_AX_BOOST_BASE_boost_path_tmp/$libsubdir/libboost_"* >/dev/null 2>&1 ; then break; fi
done
BOOST_LDFLAGS="-L$_AX_BOOST_BASE_boost_path_tmp/$libsubdir"
BOOST_CPPFLAGS="-I$_AX_BOOST_BASE_boost_path_tmp/include"
break;
fi
done
])
dnl overwrite ld flags if we have required special directory with
dnl --with-boost-libdir parameter
AS_IF([test "x$_AX_BOOST_BASE_boost_lib_path" != "x"],
[BOOST_LDFLAGS="-L$_AX_BOOST_BASE_boost_lib_path"])
AC_MSG_CHECKING([for boostlib >= $1 ($WANT_BOOST_VERSION)])
CPPFLAGS_SAVED="$CPPFLAGS"
CPPFLAGS="$CPPFLAGS $BOOST_CPPFLAGS"
export CPPFLAGS
LDFLAGS_SAVED="$LDFLAGS"
LDFLAGS="$LDFLAGS $BOOST_LDFLAGS"
export LDFLAGS
AC_REQUIRE([AC_PROG_CXX])
AC_LANG_PUSH(C++)
AC_COMPILE_IFELSE([_AX_BOOST_BASE_PROGRAM($WANT_BOOST_VERSION)],[
AC_MSG_RESULT(yes)
succeeded=yes
found_system=yes
],[
])
AC_LANG_POP([C++])
dnl if we found no boost with system layout we search for boost libraries
dnl built and installed without the --layout=system option or for a staged(not installed) version
if test "x$succeeded" != "xyes" ; then
CPPFLAGS="$CPPFLAGS_SAVED"
LDFLAGS="$LDFLAGS_SAVED"
BOOST_CPPFLAGS=
if test -z "$_AX_BOOST_BASE_boost_lib_path" ; then
BOOST_LDFLAGS=
fi
_version=0
if test -n "$_AX_BOOST_BASE_boost_path" ; then
if test -d "$_AX_BOOST_BASE_boost_path" && test -r "$_AX_BOOST_BASE_boost_path"; then
for i in `ls -d $_AX_BOOST_BASE_boost_path/include/boost-* 2>/dev/null`; do
_version_tmp=`echo $i | sed "s#$_AX_BOOST_BASE_boost_path##" | sed 's/\/include\/boost-//' | sed 's/_/./'`
V_CHECK=`expr $_version_tmp \> $_version`
if test "x$V_CHECK" = "x1" ; then
_version=$_version_tmp
fi
VERSION_UNDERSCORE=`echo $_version | sed 's/\./_/'`
BOOST_CPPFLAGS="-I$_AX_BOOST_BASE_boost_path/include/boost-$VERSION_UNDERSCORE"
done
dnl if nothing found search for layout used in Windows distributions
if test -z "$BOOST_CPPFLAGS"; then
if test -d "$_AX_BOOST_BASE_boost_path/boost" && test -r "$_AX_BOOST_BASE_boost_path/boost"; then
BOOST_CPPFLAGS="-I$_AX_BOOST_BASE_boost_path"
fi
fi
dnl if we found something and BOOST_LDFLAGS was unset before
dnl (because "$_AX_BOOST_BASE_boost_lib_path" = ""), set it here.
if test -n "$BOOST_CPPFLAGS" && test -z "$BOOST_LDFLAGS"; then
for libsubdir in $libsubdirs ; do
if ls "$_AX_BOOST_BASE_boost_path/$libsubdir/libboost_"* >/dev/null 2>&1 ; then break; fi
done
BOOST_LDFLAGS="-L$_AX_BOOST_BASE_boost_path/$libsubdir"
fi
fi
else
if test "x$cross_compiling" != "xyes" ; then
for _AX_BOOST_BASE_boost_path in /usr /usr/local /opt /opt/local ; do
if test -d "$_AX_BOOST_BASE_boost_path" && test -r "$_AX_BOOST_BASE_boost_path" ; then
for i in `ls -d $_AX_BOOST_BASE_boost_path/include/boost-* 2>/dev/null`; do
_version_tmp=`echo $i | sed "s#$_AX_BOOST_BASE_boost_path##" | sed 's/\/include\/boost-//' | sed 's/_/./'`
V_CHECK=`expr $_version_tmp \> $_version`
if test "x$V_CHECK" = "x1" ; then
_version=$_version_tmp
best_path=$_AX_BOOST_BASE_boost_path
fi
done
fi
done
VERSION_UNDERSCORE=`echo $_version | sed 's/\./_/'`
BOOST_CPPFLAGS="-I$best_path/include/boost-$VERSION_UNDERSCORE"
if test -z "$_AX_BOOST_BASE_boost_lib_path" ; then
for libsubdir in $libsubdirs ; do
if ls "$best_path/$libsubdir/libboost_"* >/dev/null 2>&1 ; then break; fi
done
BOOST_LDFLAGS="-L$best_path/$libsubdir"
fi
fi
if test -n "$BOOST_ROOT" ; then
for libsubdir in $libsubdirs ; do
if ls "$BOOST_ROOT/stage/$libsubdir/libboost_"* >/dev/null 2>&1 ; then break; fi
done
if test -d "$BOOST_ROOT" && test -r "$BOOST_ROOT" && test -d "$BOOST_ROOT/stage/$libsubdir" && test -r "$BOOST_ROOT/stage/$libsubdir"; then
version_dir=`expr //$BOOST_ROOT : '.*/\(.*\)'`
stage_version=`echo $version_dir | sed 's/boost_//' | sed 's/_/./g'`
stage_version_shorten=`expr $stage_version : '\([[0-9]]*\.[[0-9]]*\)'`
V_CHECK=`expr $stage_version_shorten \>\= $_version`
if test "x$V_CHECK" = "x1" && test -z "$_AX_BOOST_BASE_boost_lib_path" ; then
AC_MSG_NOTICE(We will use a staged boost library from $BOOST_ROOT)
BOOST_CPPFLAGS="-I$BOOST_ROOT"
BOOST_LDFLAGS="-L$BOOST_ROOT/stage/$libsubdir"
fi
fi
fi
fi
CPPFLAGS="$CPPFLAGS $BOOST_CPPFLAGS"
export CPPFLAGS
LDFLAGS="$LDFLAGS $BOOST_LDFLAGS"
export LDFLAGS
AC_LANG_PUSH(C++)
AC_COMPILE_IFELSE([_AX_BOOST_BASE_PROGRAM($WANT_BOOST_VERSION)],[
AC_MSG_RESULT(yes)
succeeded=yes
found_system=yes
],[
])
AC_LANG_POP([C++])
fi
if test "x$succeeded" != "xyes" ; then
if test "x$_version" = "x0" ; then
AC_MSG_NOTICE([[We could not detect the boost libraries (version $1 or higher). If you have a staged boost library (still not installed) please specify \$BOOST_ROOT in your environment and do not give a PATH to --with-boost option. If you are sure you have boost installed, then check your version number looking in <boost/version.hpp>. See http://randspringer.de/boost for more documentation.]])
else
AC_MSG_NOTICE([Your boost libraries seems to old (version $_version).])
fi
# execute ACTION-IF-NOT-FOUND (if present):
ifelse([$3], , :, [$3])
else
AC_DEFINE(HAVE_BOOST,,[define if the Boost library is available])
# execute ACTION-IF-FOUND (if present):
ifelse([$2], , :, [$2])
fi
CPPFLAGS="$CPPFLAGS_SAVED"
LDFLAGS="$LDFLAGS_SAVED"
])
================================================
FILE: ax_boost_filesystem.m4
================================================
# ===========================================================================
# https://www.gnu.org/software/autoconf-archive/ax_boost_filesystem.html
# ===========================================================================
#
# SYNOPSIS
#
# AX_BOOST_FILESYSTEM
#
# DESCRIPTION
#
# Test for Filesystem library from the Boost C++ libraries. The macro
# requires a preceding call to AX_BOOST_BASE. Further documentation is
# available at <http://randspringer.de/boost/index.html>.
#
# This macro calls:
#
# AC_SUBST(BOOST_FILESYSTEM_LIB)
#
# And sets:
#
# HAVE_BOOST_FILESYSTEM
#
# LICENSE
#
# Copyright (c) 2009 Thomas Porschberg <thomas@randspringer.de>
# Copyright (c) 2009 Michael Tindal
# Copyright (c) 2009 Roman Rybalko <libtorrent@romanr.info>
#
# Copying and distribution of this file, with or without modification, are
# permitted in any medium without royalty provided the copyright notice
# and this notice are preserved. This file is offered as-is, without any
# warranty.
#serial 27
AC_DEFUN([AX_BOOST_FILESYSTEM],
[
AC_ARG_WITH([boost-filesystem],
AS_HELP_STRING([--with-boost-filesystem@<:@=special-lib@:>@],
[use the Filesystem library from boost - it is possible to specify a certain library for the linker
e.g. --with-boost-filesystem=boost_filesystem-gcc-mt ]),
[
if test "$withval" = "no"; then
want_boost="no"
elif test "$withval" = "yes"; then
want_boost="yes"
ax_boost_user_filesystem_lib=""
else
want_boost="yes"
ax_boost_user_filesystem_lib="$withval"
fi
],
[want_boost="yes"]
)
if test "x$want_boost" = "xyes"; then
AC_REQUIRE([AC_PROG_CC])
CPPFLAGS_SAVED="$CPPFLAGS"
CPPFLAGS="$CPPFLAGS $BOOST_CPPFLAGS"
export CPPFLAGS
LDFLAGS_SAVED="$LDFLAGS"
LDFLAGS="$LDFLAGS $BOOST_LDFLAGS"
export LDFLAGS
LIBS_SAVED=$LIBS
LIBS="$LIBS $BOOST_SYSTEM_LIB"
export LIBS
AC_CACHE_CHECK(whether the Boost::Filesystem library is available,
ax_cv_boost_filesystem,
[AC_LANG_PUSH([C++])
AC_COMPILE_IFELSE([AC_LANG_PROGRAM([[@%:@include <boost/filesystem/path.hpp>]],
[[using namespace boost::filesystem;
path my_path( "foo/bar/data.txt" );
return 0;]])],
ax_cv_boost_filesystem=yes, ax_cv_boost_filesystem=no)
AC_LANG_POP([C++])
])
if test "x$ax_cv_boost_filesystem" = "xyes"; then
AC_DEFINE(HAVE_BOOST_FILESYSTEM,,[define if the Boost::Filesystem library is available])
BOOSTLIBDIR=`echo $BOOST_LDFLAGS | sed -e 's/@<:@^\/@:>@*//'`
if test "x$ax_boost_user_filesystem_lib" = "x"; then
for libextension in `ls -r $BOOSTLIBDIR/libboost_filesystem* 2>/dev/null | sed 's,.*/lib,,' | sed 's,\..*,,'` ; do
ax_lib=${libextension}
AC_CHECK_LIB($ax_lib, main,
[BOOST_FILESYSTEM_LIB="-l$ax_lib"; AC_SUBST(BOOST_FILESYSTEM_LIB) link_filesystem="yes"; break],
[link_filesystem="no"])
done
if test "x$link_filesystem" != "xyes"; then
for libextension in `ls -r $BOOSTLIBDIR/boost_filesystem* 2>/dev/null | sed 's,.*/,,' | sed -e 's,\..*,,'` ; do
ax_lib=${libextension}
AC_CHECK_LIB($ax_lib, main,
[BOOST_FILESYSTEM_LIB="-l$ax_lib"; AC_SUBST(BOOST_FILESYSTEM_LIB) link_filesystem="yes"; break],
[link_filesystem="no"])
done
fi
else
for ax_lib in $ax_boost_user_filesystem_lib boost_filesystem-$ax_boost_user_filesystem_lib; do
AC_CHECK_LIB($ax_lib, main,
[BOOST_FILESYSTEM_LIB="-l$ax_lib"; AC_SUBST(BOOST_FILESYSTEM_LIB) link_filesystem="yes"; break],
[link_filesystem="no"])
done
fi
if test "x$ax_lib" = "x"; then
AC_MSG_ERROR(Could not find a version of the library!)
fi
if test "x$link_filesystem" != "xyes"; then
AC_MSG_ERROR(Could not link against $ax_lib !)
fi
fi
CPPFLAGS="$CPPFLAGS_SAVED"
LDFLAGS="$LDFLAGS_SAVED"
LIBS="$LIBS_SAVED"
fi
])
================================================
FILE: ax_boost_serialization.m4
================================================
# ===========================================================================
# https://www.gnu.org/software/autoconf-archive/ax_boost_serialization.html
# ===========================================================================
#
# SYNOPSIS
#
# AX_BOOST_SERIALIZATION
#
# DESCRIPTION
#
# Test for Serialization library from the Boost C++ libraries. The macro
# requires a preceding call to AX_BOOST_BASE. Further documentation is
# available at <http://randspringer.de/boost/index.html>.
#
# This macro calls:
#
# AC_SUBST(BOOST_SERIALIZATION_LIB)
#
# And sets:
#
# HAVE_BOOST_SERIALIZATION
#
# LICENSE
#
# Copyright (c) 2008 Thomas Porschberg <thomas@randspringer.de>
#
# Copying and distribution of this file, with or without modification, are
# permitted in any medium without royalty provided the copyright notice
# and this notice are preserved. This file is offered as-is, without any
# warranty.
#serial 22
AC_DEFUN([AX_BOOST_SERIALIZATION],
[
AC_ARG_WITH([boost-serialization],
AS_HELP_STRING([--with-boost-serialization@<:@=special-lib@:>@],
[use the Serialization library from boost - it is possible to specify a certain library for the linker
e.g. --with-boost-serialization=boost_serialization-gcc-mt-d-1_33_1 ]),
[
if test "$withval" = "no"; then
want_boost="no"
elif test "$withval" = "yes"; then
want_boost="yes"
ax_boost_user_serialization_lib=""
else
want_boost="yes"
ax_boost_user_serialization_lib="$withval"
fi
],
[want_boost="yes"]
)
if test "x$want_boost" = "xyes"; then
AC_REQUIRE([AC_PROG_CC])
CPPFLAGS_SAVED="$CPPFLAGS"
CPPFLAGS="$CPPFLAGS $BOOST_CPPFLAGS"
AC_MSG_WARN(BOOST_CPPFLAGS $BOOST_CPPFLAGS)
export CPPFLAGS
LDFLAGS_SAVED="$LDFLAGS"
LDFLAGS="$LDFLAGS $BOOST_LDFLAGS"
export LDFLAGS
AC_CACHE_CHECK(whether the Boost::Serialization library is available,
ax_cv_boost_serialization,
[AC_LANG_PUSH([C++])
AC_COMPILE_IFELSE([AC_LANG_PROGRAM([[@%:@include <fstream>
@%:@include <boost/archive/text_oarchive.hpp>
@%:@include <boost/archive/text_iarchive.hpp>
]],
[[std::ofstream ofs("filename");
boost::archive::text_oarchive oa(ofs);
return 0;
]])],
ax_cv_boost_serialization=yes, ax_cv_boost_serialization=no)
AC_LANG_POP([C++])
])
if test "x$ax_cv_boost_serialization" = "xyes"; then
AC_DEFINE(HAVE_BOOST_SERIALIZATION,,[define if the Boost::Serialization library is available])
BOOSTLIBDIR=`echo $BOOST_LDFLAGS | sed -e 's/@<:@^\/@:>@*//'`
if test "x$ax_boost_user_serialization_lib" = "x"; then
for libextension in `ls $BOOSTLIBDIR/libboost_serialization*.so* $BOOSTLIBDIR/libboost_serialization*.dylib* $BOOSTLIBDIR/libboost_serialization*.a* 2>/dev/null | sed 's,.*/,,' | sed -e 's;^lib\(boost_serialization.*\)\.so.*$;\1;' -e 's;^lib\(boost_serialization.*\)\.dylib.*$;\1;' -e 's;^lib\(boost_serialization.*\)\.a*$;\1;'` ; do
ax_lib=${libextension}
AC_CHECK_LIB($ax_lib, main,
[BOOST_SERIALIZATION_LIB="-l$ax_lib"; AC_SUBST(BOOST_SERIALIZATION_LIB) link_serialization="yes"; break],
[link_serialization="no"])
done
if test "x$link_serialization" != "xyes"; then
for libextension in `ls $BOOSTLIBDIR/boost_serialization*.dll* $BOOSTLIBDIR/boost_serialization*.a* 2>/dev/null | sed 's,.*/,,' | sed -e 's;^\(boost_serialization.*\)\.dll.*$;\1;' -e 's;^\(boost_serialization.*\)\.a.*$;\1;'` ; do
ax_lib=${libextension}
AC_CHECK_LIB($ax_lib, main,
[BOOST_SERIALIZATION_LIB="-l$ax_lib"; AC_SUBST(BOOST_SERIALIZATION_LIB) link_serialization="yes"; break],
[link_serialization="no"])
done
fi
else
for ax_lib in $ax_boost_user_serialization_lib boost_serialization-$ax_boost_user_serialization_lib; do
AC_CHECK_LIB($ax_lib, main,
[BOOST_SERIALIZATION_LIB="-l$ax_lib"; AC_SUBST(BOOST_SERIALIZATION_LIB) link_serialization="yes"; break],
[link_serialization="no"])
done
fi
if test "x$ax_lib" = "x"; then
AC_MSG_ERROR(Could not find a version of the library!)
fi
if test "x$link_serialization" != "xyes"; then
AC_MSG_ERROR(Could not link against $ax_lib !)
fi
fi
CPPFLAGS="$CPPFLAGS_SAVED"
LDFLAGS="$LDFLAGS_SAVED"
fi
])
================================================
FILE: ax_boost_system.m4
================================================
# ===========================================================================
# https://www.gnu.org/software/autoconf-archive/ax_boost_system.html
# ===========================================================================
#
# SYNOPSIS
#
# AX_BOOST_SYSTEM
#
# DESCRIPTION
#
# Test for System library from the Boost C++ libraries. The macro requires
# a preceding call to AX_BOOST_BASE. Further documentation is available at
# <http://randspringer.de/boost/index.html>.
#
# This macro calls:
#
# AC_SUBST(BOOST_SYSTEM_LIB)
#
# And sets:
#
# HAVE_BOOST_SYSTEM
#
# LICENSE
#
# Copyright (c) 2008 Thomas Porschberg <thomas@randspringer.de>
# Copyright (c) 2008 Michael Tindal
# Copyright (c) 2008 Daniel Casimiro <dan.casimiro@gmail.com>
#
# Copying and distribution of this file, with or without modification, are
# permitted in any medium without royalty provided the copyright notice
# and this notice are preserved. This file is offered as-is, without any
# warranty.
#serial 19
AC_DEFUN([AX_BOOST_SYSTEM],
[
AC_ARG_WITH([boost-system],
AS_HELP_STRING([--with-boost-system@<:@=special-lib@:>@],
[use the System library from boost - it is possible to specify a certain library for the linker
e.g. --with-boost-system=boost_system-gcc-mt ]),
[
if test "$withval" = "no"; then
want_boost="no"
elif test "$withval" = "yes"; then
want_boost="yes"
ax_boost_user_system_lib=""
else
want_boost="yes"
ax_boost_user_system_lib="$withval"
fi
],
[want_boost="yes"]
)
if test "x$want_boost" = "xyes"; then
AC_REQUIRE([AC_PROG_CC])
AC_REQUIRE([AC_CANONICAL_BUILD])
CPPFLAGS_SAVED="$CPPFLAGS"
CPPFLAGS="$CPPFLAGS $BOOST_CPPFLAGS"
export CPPFLAGS
LDFLAGS_SAVED="$LDFLAGS"
LDFLAGS="$LDFLAGS $BOOST_LDFLAGS"
export LDFLAGS
AC_CACHE_CHECK(whether the Boost::System library is available,
ax_cv_boost_system,
[AC_LANG_PUSH([C++])
CXXFLAGS_SAVE=$CXXFLAGS
CXXFLAGS=
AC_COMPILE_IFELSE([AC_LANG_PROGRAM([[@%:@include <boost/system/error_code.hpp>]],
[[boost::system::error_category *a = 0;]])],
ax_cv_boost_system=yes, ax_cv_boost_system=no)
CXXFLAGS=$CXXFLAGS_SAVE
AC_LANG_POP([C++])
])
if test "x$ax_cv_boost_system" = "xyes"; then
AC_SUBST(BOOST_CPPFLAGS)
AC_DEFINE(HAVE_BOOST_SYSTEM,,[define if the Boost::System library is available])
BOOSTLIBDIR=`echo $BOOST_LDFLAGS | sed -e 's/@<:@^\/@:>@*//'`
LDFLAGS_SAVE=$LDFLAGS
if test "x$ax_boost_user_system_lib" = "x"; then
for libextension in `ls -r $BOOSTLIBDIR/libboost_system* 2>/dev/null | sed 's,.*/lib,,' | sed 's,\..*,,'` ; do
ax_lib=${libextension}
AC_CHECK_LIB($ax_lib, main,
[BOOST_SYSTEM_LIB="-l$ax_lib"; AC_SUBST(BOOST_SYSTEM_LIB) link_system="yes"; break],
[link_system="no"])
done
if test "x$link_system" != "xyes"; then
for libextension in `ls -r $BOOSTLIBDIR/boost_system* 2>/dev/null | sed 's,.*/,,' | sed -e 's,\..*,,'` ; do
ax_lib=${libextension}
AC_CHECK_LIB($ax_lib, main,
[BOOST_SYSTEM_LIB="-l$ax_lib"; AC_SUBST(BOOST_SYSTEM_LIB) link_system="yes"; break],
[link_system="no"])
done
fi
else
for ax_lib in $ax_boost_user_system_lib boost_system-$ax_boost_user_system_lib; do
AC_CHECK_LIB($ax_lib, main,
[BOOST_SYSTEM_LIB="-l$ax_lib"; AC_SUBST(BOOST_SYSTEM_LIB) link_system="yes"; break],
[link_system="no"])
done
fi
if test "x$ax_lib" = "x"; then
AC_MSG_ERROR(Could not find a version of the library!)
fi
if test "x$link_system" = "xno"; then
AC_MSG_ERROR(Could not link against $ax_lib !)
fi
fi
CPPFLAGS="$CPPFLAGS_SAVED"
LDFLAGS="$LDFLAGS_SAVED"
fi
])
================================================
FILE: ax_boost_thread.m4
================================================
# ===========================================================================
# https://www.gnu.org/software/autoconf-archive/ax_boost_thread.html
# ===========================================================================
#
# SYNOPSIS
#
# AX_BOOST_THREAD
#
# DESCRIPTION
#
# Test for Thread library from the Boost C++ libraries. The macro requires
# a preceding call to AX_BOOST_BASE. Further documentation is available at
# <http://randspringer.de/boost/index.html>.
#
# This macro calls:
#
# AC_SUBST(BOOST_THREAD_LIB)
#
# And sets:
#
# HAVE_BOOST_THREAD
#
# LICENSE
#
# Copyright (c) 2009 Thomas Porschberg <thomas@randspringer.de>
# Copyright (c) 2009 Michael Tindal
#
# Copying and distribution of this file, with or without modification, are
# permitted in any medium without royalty provided the copyright notice
# and this notice are preserved. This file is offered as-is, without any
# warranty.
#serial 31
AC_DEFUN([AX_BOOST_THREAD],
[
AC_ARG_WITH([boost-thread],
AS_HELP_STRING([--with-boost-thread@<:@=special-lib@:>@],
[use the Thread library from boost -
it is possible to specify a certain library for the linker
e.g. --with-boost-thread=boost_thread-gcc-mt ]),
[
if test "$withval" = "yes"; then
want_boost="yes"
ax_boost_user_thread_lib=""
else
want_boost="yes"
ax_boost_user_thread_lib="$withval"
fi
],
[want_boost="yes"]
)
if test "x$want_boost" = "xyes"; then
AC_REQUIRE([AC_PROG_CC])
AC_REQUIRE([AC_CANONICAL_BUILD])
CPPFLAGS_SAVED="$CPPFLAGS"
CPPFLAGS="$CPPFLAGS $BOOST_CPPFLAGS"
export CPPFLAGS
LDFLAGS_SAVED="$LDFLAGS"
LDFLAGS="$LDFLAGS $BOOST_LDFLAGS"
export LDFLAGS
AC_CACHE_CHECK(whether the Boost::Thread library is available,
ax_cv_boost_thread,
[AC_LANG_PUSH([C++])
CXXFLAGS_SAVE=$CXXFLAGS
if test "x$host_os" = "xsolaris" ; then
CXXFLAGS="-pthreads $CXXFLAGS"
elif test "x$host_os" = "xmingw32" ; then
CXXFLAGS="-mthreads $CXXFLAGS"
else
CXXFLAGS="-pthread $CXXFLAGS"
fi
AC_COMPILE_IFELSE([
AC_LANG_PROGRAM(
[[@%:@include <boost/thread/thread.hpp>]],
[[boost::thread_group thrds;
return 0;]])],
ax_cv_boost_thread=yes, ax_cv_boost_thread=no)
CXXFLAGS=$CXXFLAGS_SAVE
AC_LANG_POP([C++])
])
if test "x$ax_cv_boost_thread" = "xyes"; then
if test "x$host_os" = "xsolaris" ; then
BOOST_CPPFLAGS="-pthreads $BOOST_CPPFLAGS"
elif test "x$host_os" = "xmingw32" ; then
BOOST_CPPFLAGS="-mthreads $BOOST_CPPFLAGS"
else
BOOST_CPPFLAGS="-pthread $BOOST_CPPFLAGS"
fi
AC_SUBST(BOOST_CPPFLAGS)
AC_DEFINE(HAVE_BOOST_THREAD,,
[define if the Boost::Thread library is available])
BOOSTLIBDIR=`echo $BOOST_LDFLAGS | sed -e 's/@<:@^\/@:>@*//'`
LDFLAGS_SAVE=$LDFLAGS
case "x$host_os" in
*bsd* )
LDFLAGS="-pthread $LDFLAGS"
break;
;;
esac
if test "x$ax_boost_user_thread_lib" = "x"; then
for libextension in `ls -r $BOOSTLIBDIR/libboost_thread* 2>/dev/null | sed 's,.*/lib,,' | sed 's,\..*,,'`; do
ax_lib=${libextension}
AC_CHECK_LIB($ax_lib, main,
[link_thread="yes"; break],
[link_thread="no"])
done
if test "x$link_thread" != "xyes"; then
for libextension in `ls -r $BOOSTLIBDIR/boost_thread* 2>/dev/null | sed 's,.*/,,' | sed 's,\..*,,'`; do
ax_lib=${libextension}
AC_CHECK_LIB($ax_lib, main,
[link_thread="yes"; break],
[link_thread="no"])
done
fi
else
for ax_lib in $ax_boost_user_thread_lib boost_thread-$ax_boost_user_thread_lib; do
AC_CHECK_LIB($ax_lib, main,
[link_thread="yes"; break],
[link_thread="no"])
done
fi
if test "x$ax_lib" = "x"; then
AC_MSG_ERROR(Could not find a version of the library!)
fi
if test "x$link_thread" = "xno"; then
AC_MSG_ERROR(Could not link against $ax_lib !)
else
BOOST_THREAD_LIB="-l$ax_lib"
case "x$host_os" in
*bsd* )
BOOST_LDFLAGS="-pthread $BOOST_LDFLAGS"
break;
;;
xsolaris )
BOOST_THREAD_LIB="$BOOST_THREAD_LIB -lpthread"
break;
;;
xmingw32 )
break;
;;
* )
BOOST_THREAD_LIB="$BOOST_THREAD_LIB -lpthread"
break;
;;
esac
AC_SUBST(BOOST_THREAD_LIB)
fi
fi
CPPFLAGS="$CPPFLAGS_SAVED"
LDFLAGS="$LDFLAGS_SAVED"
fi
])
================================================
FILE: ax_check_eigen.m4
================================================
# SYNOPSIS
#
# AX_EIGEN
#
# DESCRIPTION
#
# Test for the EIGEN libraries of a particular version (or newer)
#
# If no path to the installed eigen library is given the macro searchs
# under /usr, /usr/local, /opt and /opt/local and evaluates the
# $EIGEN_ROOT environment variable.
# Adapted from AX_BOOST_BASE
#
# This macro calls:
#
# AC_SUBST(EIGEN_CPPFLAGS) / AC_SUBST(EIGEN_LDFLAGS)
#
# And sets:
#
# HAVE_EIGEN
#
# LICENSE
#
# Copyright (c) 2010 Cole Trapnell <cole@cs.umd.edu>
#
# Copying and distribution of this file, with or without modification, are
# permitted in any medium without royalty provided the copyright notice
# and this notice are preserved.
AC_DEFUN([AX_EIGEN],
[
AC_ARG_WITH([eigen],
AS_HELP_STRING([--with-eigen@<:@=DIR@:>@], [use EIGEN libraries (default is yes) - it is possible to specify the root directory for EIGEN (optional)]),
[
if test "$withval" = "no"; then
want_eigen="no"
elif test "$withval" = "yes"; then
want_eigen="yes"
ac_eigen_path=""
else
want_eigen="yes"
ac_eigen_path="$withval"
fi
],
[want_eigen="yes"])
if test "x$want_eigen" = "xyes"; then
AC_MSG_CHECKING(for eigenlib)
succeeded=no
dnl first we check the system location for eigen libraries
if test "$ac_eigen_path" != ""; then
EIGEN_CPPFLAGS="-I$ac_eigen_path/include"
else
for ac_eigen_path_tmp in /usr /usr/local /opt /opt/local ; do
for ac_eigen_subdir in eigen eigen3 ; do
ac_candidate_path="$ac_eigen_path_tmp/include/$ac_eigen_subdir"
if test -d "$ac_candidate_path" && test -r "$ac_candidate_path"; then
EIGEN_CPPFLAGS="-I$ac_candidate_path"
break;
fi
done
done
fi
CPPFLAGS_SAVED="$CPPFLAGS"
CPPFLAGS="$CPPFLAGS $EIGEN_CPPFLAGS"
export EIGEN_CPPFLAGS
AC_LANG_PUSH(C++)
AC_COMPILE_IFELSE([AC_LANG_PROGRAM([[
@%:@include <Eigen/Dense>
]], [[
]])],[
AC_MSG_RESULT(yes)
succeeded=yes
found_system=yes
],[
AC_MSG_ERROR([[We could not detect the Eigen3 library. Try installing libeigen3, or specifying a path with --with-eigen=/some/path]])
])
AC_LANG_POP([C++])
CPPFLAGS="$CPPFLAGS $EIGEN_CPPFLAGS"
export CPPFLAGS
LDFLAGS="$LDFLAGS $EIGEN_LDFLAGS"
export LDFLAGS
export EIGEN_CPPFLAGS
if test "$succeeded" == "yes" ; then
AC_SUBST(EIGEN_CPPFLAGS)
AC_DEFINE(HAVE_EIGEN,,[define if the EIGEN library is available])
fi
CPPFLAGS="$CPPFLAGS_SAVED"
LDFLAGS="$LDFLAGS_SAVED"
fi
])
================================================
FILE: ax_check_zlib.m4
================================================
# ===========================================================================
# http://www.gnu.org/software/autoconf-archive/ax_check_zlib.html
# ===========================================================================
#
# SYNOPSIS
#
# AX_CHECK_ZLIB()
#
# DESCRIPTION
#
# This macro searches for an installed zlib library. If nothing was
# specified when calling configure, it searches first in /usr/local and
# then in /usr. If the --with-zlib=DIR is specified, it will try to find
# it in DIR/include/zlib.h and DIR/lib/libz.a. If --without-zlib is
# specified, the library is not searched at all.
#
# If either the header file (zlib.h) or the library (libz) is not found,
# the configuration exits on error, asking for a valid zlib installation
# directory or --without-zlib.
#
# The macro defines the symbol HAVE_LIBZ if the library is found. You
# should use autoheader to include a definition for this symbol in a
# config.h file. Sample usage in a C/C++ source is as follows:
#
# #ifdef HAVE_LIBZ
# #include <zlib.h>
# #endif /* HAVE_LIBZ */
#
# LICENSE
#
# Copyright (c) 2008 Loic Dachary <loic@senga.org>
#
# This program is free software; you can redistribute it and/or modify it
# under the terms of the GNU General Public License as published by the
# Free Software Foundation; either version 2 of the License, or (at your
# option) any later version.
#
# This program is distributed in the hope that it will be useful, but
# WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General
# Public License for more details.
#
# You should have received a copy of the GNU General Public License along
# with this program. If not, see <http://www.gnu.org/licenses/>.
#
# As a special exception, the respective Autoconf Macro's copyright owner
# gives unlimited permission to copy, distribute and modify the configure
# scripts that are the output of Autoconf when processing the Macro. You
# need not follow the terms of the GNU General Public License when using
# or distributing such scripts, even though portions of the text of the
# Macro appear in them. The GNU General Public License (GPL) does govern
# all other use of the material that constitutes the Autoconf Macro.
#
# This special exception to the GPL applies to versions of the Autoconf
# Macro released by the Autoconf Archive. When you make and distribute a
# modified version of the Autoconf Macro, you may extend this special
# exception to the GPL to apply to your modified version as well.
#serial 7
AU_ALIAS([CHECK_ZLIB], [AX_CHECK_ZLIB])
AC_DEFUN([AX_CHECK_ZLIB],
#
# Handle user hints
#
[AC_MSG_CHECKING(if zlib is wanted)
AC_ARG_WITH(zlib,
[ --with-zlib=DIR root directory path of zlib installation [defaults to
/usr/local or /usr if not found in /usr/local]
--without-zlib to disable zlib usage completely],
[if test "$withval" != no ; then
AC_MSG_RESULT(yes)
if test -d "$withval"
then
ZLIB_HOME="$withval"
else
AC_MSG_WARN([Sorry, $withval does not exist, checking usual places])
fi
else
AC_MSG_RESULT(no)
fi],
[AC_MSG_RESULT(yes)])
ZLIB_HOME=/usr/local
if test ! -f "${ZLIB_HOME}/include/zlib.h"
then
ZLIB_HOME=/usr
fi
#
# Locate zlib, if wanted
#
if test -n "${ZLIB_HOME}"
then
ZLIB_OLD_LDFLAGS=$LDFLAGS
ZLIB_OLD_CPPFLAGS=$LDFLAGS
LDFLAGS="$LDFLAGS -L${ZLIB_HOME}/lib"
CPPFLAGS="$CPPFLAGS -I${ZLIB_HOME}/include"
AC_LANG_SAVE
AC_LANG_C
AC_CHECK_LIB(z, inflateEnd, [zlib_cv_libz=yes], [zlib_cv_libz=no])
AC_CHECK_HEADER(zlib.h, [zlib_cv_zlib_h=yes], [zlib_cv_zlib_h=no])
AC_LANG_RESTORE
if test "$zlib_cv_libz" = "yes" -a "$zlib_cv_zlib_h" = "yes"
then
#
# If both library and header were found, use them
#
AC_CHECK_LIB(z, inflateEnd)
AC_MSG_CHECKING(zlib in ${ZLIB_HOME})
AC_MSG_RESULT(ok)
ZLIB="-lz"
AC_SUBST(ZLIB)
else
#
# If either header or library was not found, revert and bomb
#
AC_MSG_CHECKING(zlib in ${ZLIB_HOME})
LDFLAGS="$ZLIB_OLD_LDFLAGS"
CPPFLAGS="$ZLIB_OLD_CPPFLAGS"
AC_MSG_RESULT(failed)
AC_MSG_ERROR(either specify a valid zlib installation with --with-zlib=DIR or disable zlib usage with --without-zlib)
fi
fi
])
================================================
FILE: ax_openmp.m4
================================================
# AC_C_OPENMP
# -----------
# Check which options need to be passed to the C compiler to support OpenMP.
# Set the OPENMP_CFLAGS variable to these options.
# The options are necessary at compile time (so the #pragmas are understood)
# and at link time (so the appropriate library is linked with).
# This macro takes care to not produce redundant options if $CC $CFLAGS
already
# supports OpenMP. It also is careful to not pass options to compilers that
# misinterpret them; for example, most compilers accept "-openmp" and create
# an output file called 'penmp' rather than activating OpenMP support.
AC_DEFUN([AC_C_OPENMP],
[
AC_MSG_CHECKING([whether to use OpenMP])
AC_ARG_ENABLE(openmp,
[AS_HELP_STRING([--disable-openmp], [do not use OpenMP])],
[],
[enable_openmp=yes])
AC_MSG_RESULT([$enable_openmp])
OPENMP_CFLAGS=
if test "$enable_openmp" = yes; then
AC_MSG_CHECKING([for $CC option to support OpenMP])
AC_CACHE_VAL([ac_cv_prog_cc_openmp], [
ac_cv_prog_cc_openmp=unsupported
AC_LINK_IFELSE([
#ifndef _OPENMP
choke me
#endif
#include <omp.h>
int main () { return omp_get_num_threads (); }
], [ac_cv_prog_cc_openmp="none needed"])
if test "$ac_cv_prog_cc_openmp" = unsupported; then
dnl Try these flags:
dnl GCC >= 4.2 -fopenmp
dnl SunPRO C -xopenmp
dnl Intel C -openmp
dnl SGI C, PGI C -mp
dnl Tru64 Compaq C -omp
dnl IBM C (AIX, Linux) -qsmp=omp
for brand in GCC SunPRO Intel SGI/PGI Compaq IBM; do
case $brand in
GCC)
ac_conditional='defined __GNUC__'
ac_option='-fopenmp' ;;
SunPRO)
ac_conditional='defined __SUNPRO_C || defined __SUNPRO_CC'
ac_option='-xopenmp' ;;
Intel)
ac_conditional='defined __INTEL_COMPILER'
ac_option='-openmp' ;;
SGI/PGI)
ac_conditional='defined __sgi || defined __PGI || defined
__PGIC__'
ac_option='-mp' ;;
Compaq)
ac_conditional='defined __DECC || defined __DECCXX'
ac_option='-omp' ;;
IBM)
ac_conditional='defined __xlc__ || defined __xlC__'
ac_option='-qsmp=omp' ;;
esac
if test $brand = GCC; then
if test "$GCC" = yes; then
ac_openmp_result=yes
else
ac_openmp_result=no
fi
else
AC_EGREP_CPP([Brand], [
#if $ac_conditional
Brand
#endif
], [ac_openmp_result=yes], [ac_openmp_result=no])
fi
if test $ac_openmp_result = yes; then
ac_save_CFLAGS=$CFLAGS
CFLAGS="$CFLAGS $ac_option"
AC_LINK_IFELSE([
#ifndef _OPENMP
choke me
#endif
#include <omp.h>
int main () { return omp_get_num_threads (); }
], [ac_cv_prog_cc_openmp=$ac_option])
CFLAGS=$ac_save_CFLAGS
break
fi
done
fi
])
AC_MSG_RESULT([$ac_cv_prog_cc_openmp])
case $ac_cv_prog_cc_openmp in
"none needed" | unsupported)
OPENMP_CFLAGS= ;;
*)
OPENMP_CFLAGS=$ac_cv_prog_cc_openmp ;;
esac
fi
AC_SUBST([OPENMP_CFLAGS])
])
================================================
FILE: boost.m4
================================================
dnl AC_PATH_BOOST([MINIMUM-VERSION], [ACTION-IF-FOUND], [ACTION-IF-NOT-FOUND])
dnl Test for the Boost C++ libraries of a particular version (or newer)
dnl Defines:
dnl BOOST_CXXFLAGS to the set of flags required to compiled Boost
AC_DEFUN([AC_PATH_BOOST],
[
BOOST_CXXFLAGS=""
path_given="no"
dnl Extract the path name from a --with-boost=PATH argument
AC_ARG_WITH(boost,
[ --with-boost=PATH absolute path name where the Boost C++ libraries
reside. Alternatively, the BOOST_ROOT environment variable will be used],
if test "$withval" = no ; then
path_given="no"
BOOST_CXXFLAGS=""
else
if test "$withval" != yes ; then
path_given="yes"
BOOST_CXXFLAGS="-I$withval"
BOOST_ROOT="$withval"
fi
fi
)
dnl If no path with given and there is a BOOST_ROOT environment variable,
dnl use it
if test "$path_given" = "no"; then
if test "x$BOOST_ROOT" = "x"; then
BOOST_CXXFLAGS=""
else
BOOST_CXXFLAGS="-I$BOOST_ROOT"
fi
fi
boost_min_version=ifelse([$1], ,1.20.0,$1)
AC_LANG_SAVE
AC_LANG_CPLUSPLUS
OLD_CXX_FLAGS=$CXXFLAGS
CXXFLAGS="$CXXFLAGS $BOOST_CXXFLAGS"
AC_MSG_CHECKING([for the Boost C++ libraries, version $boost_min_version or newer])
AC_TRY_COMPILE(
[
#include <boost/version.hpp>
],
[],
[
have_boost="yes"
],
[
AC_MSG_RESULT(no)
have_boost="no"
ifelse([$3], , :, [$3])
])
if test "$have_boost" = "yes"; then
WANT_BOOST_MAJOR=`expr $boost_min_version : '\([[0-9]]\+\)'`
WANT_BOOST_MINOR=`expr $boost_min_version : '[[0-9]]\+\.\([[0-9]]\+\)'`
WANT_BOOST_SUB_MINOR=`expr $boost_min_version : '[[0-9]]\+\.[[0-9]]\+\.\([[0-9]]\+\)'`
WANT_BOOST_VERSION=`expr $WANT_BOOST_MAJOR \* 100000 \+ $WANT_BOOST_MINOR \* 100 \+ $WANT_BOOST_SUB_MINOR`
AC_TRY_COMPILE(
[
#include <boost/version.hpp>
],
[
#if BOOST_VERSION >= $WANT_BOOST_VERSION
// Everything is okay
#else
# error Boost version is too old
#endif
],
[
AC_MSG_RESULT(yes)
ifelse([$2], , :, [$2])
],
[
AC_MSG_RESULT([no, version of installed Boost libraries is too old])
ifelse([$3], , :, [$3])
])
fi
CXXFLAGS=$OLD_CXXFLAGS
AC_LANG_RESTORE
])
================================================
FILE: configure.ac
================================================
m4_include([ax_boost_base.m4])
m4_include([ax_boost_thread.m4])
m4_include([ax_boost_system.m4])
m4_include([ax_boost_serialization.m4])
m4_include([ax_boost_filesystem.m4])
m4_include([ax_bam.m4])
m4_include([ax_check_eigen.m4])
m4_include([ax_check_zlib.m4])
define([svnversion], esyscmd([sh -c "svnversion|tr -d '\n'"]))dnl
AC_INIT([cufflinks], [2.2.2], [cole@cs.umd.edu])
AC_DEFINE(SVN_REVISION, "svnversion", [SVN Revision])
AC_CONFIG_SRCDIR([config.h.in])
AC_CONFIG_HEADERS([config.h])
AC_CONFIG_AUX_DIR([build-aux])
AM_INIT_AUTOMAKE
#AM_PATH_CPPUNIT(1.10.2)
AC_ARG_VAR(PYTHON, [python program])
# Make sure CXXFLAGS is defined so that AC_PROG_CXX doesn't set it.
CXXFLAGS="$CXXFLAGS"
CFLAGS="$CFLAGS"
AC_LANG(C)
# Checks for programs.
AC_PROG_AWK
AC_PROG_CXX
AC_PROG_CC
AC_PROG_MAKE_SET
AC_PROG_RANLIB
AC_PROG_INSTALL
m4_ifdef([AM_PROG_AR], [AM_PROG_AR])
AM_PATH_PYTHON([2.4])
AX_BOOST_BASE([1.47.0])
AX_BAM
AX_BOOST_SYSTEM
AX_BOOST_SERIALIZATION
AX_BOOST_FILESYSTEM
AX_BOOST_THREAD
AX_CHECK_ZLIB()
#PKG_CHECK_MODULES([EIGEN3], [eigen3])
AX_EIGEN
# Checks for header files.
AC_CHECK_HEADERS([stdlib.h string.h unistd.h])
# Checks for typedefs, structures, and compiler characteristics.
AC_HEADER_STDBOOL
AC_C_INLINE
AC_TYPE_PID_T
AC_TYPE_SIZE_T
AC_CHECK_TYPES([ptrdiff_t])
# Checks for library functions.
#AC_FUNC_FORK
#AC_CHECK_FUNCS([floor memmove pow regcomp sqrt strchr strcspn strspn strstr])
# check the platform
AC_CANONICAL_HOST
# set CFLAGS and CXXFLAGS
user_CFLAGS=${CFLAGS}
generic_CFLAGS="-Wall -Wno-strict-aliasing -g -gdwarf-2 -Wunused -Wuninitialized -ftemplate-depth-1024"
ext_CFLAGS=""
debug_CFLAGS=""
#echo "${host_cpu}-${host_os}"
case "${host_cpu}-${host_os}" in
i*86-*linux*)
ext_CFLAGS="-march=i686";;
i*86-darwin*)
CFLAGS="-m64"
AC_COMPILE_IFELSE([AC_LANG_PROGRAM], [ext_CFLAGS="-arch x86_64"], []);;
*)
AC_MSG_CHECKING([if gcc accepts -m64])
CFLAGS="-m64"
AC_COMPILE_IFELSE([AC_LANG_PROGRAM], [ext_CFLAGS="-m64"; AC_MSG_RESULT([yes])],
[ext_CFLAGS="-D_FILE_OFFSET_BITS=64"; AC_MSG_RESULT([no])]);;
esac
AC_ARG_ENABLE(vectorize, [ --enable-vectorize Enable GCC auto-vectorization],
[ext_CFLAGS="${ext_CFLAGS} -ftree-vectorize -msse3 -ffast-math -ftree-vectorizer-verbose=99"], [])
AC_ARG_ENABLE(intel64, [ --enable-intel64 optimize for Intel64 CPU such as Xeon and Core2],
[ext_CFLAGS="${ext_CFLAGS} -march=nocona"], [])
AC_ARG_ENABLE([debug],
[AS_HELP_STRING([--enable-debug],
[enable debugging info (default is no)])],
[], [enable_debug=no])
AC_ARG_ENABLE([optim],
[AS_HELP_STRING([--enable-optim@<:@=0|1|2|3@:>@],
[set optimization level (default is 3)])],
[if test "x$enable_optim" = xyes; then enable_optim=3; fi],
[enable_optim=3])
AS_IF([test "x$enable_optim" != xno], [ext_CFLAGS="$ext_CFLAGS -O$enable_optim"])
AS_IF([test "x$enable_debug" = xyes],
[debug_CFLAGS="-DDEBUG"],
[debug_CFLAGS="-DNDEBUG"])
AC_ARG_ENABLE(profiling, [ --enable-profiling enable profiling with google-perftools],
[ext_LDFLAGS="-lprofiler -ltcmalloc"], [])
CFLAGS="${generic_CFLAGS} ${ext_CFLAGS} ${user_CFLAGS} ${debug_CFLAGS} ${OPENMP_CFLAGS}"
CXXFLAGS="$CFLAGS -std=c++03"
CXXFLAGS="${CXXFLAGS} ${BOOST_CPPFLAGS} ${BAM_CPPFLAGS} ${EIGEN_CPPFLAGS}"
user_LDFLAGS="$LDFLAGS"
LDFLAGS="${ext_LDFLAGS} ${user_LDFLAGS}"
# Checks for structures/functions that can be used to determine system memory
AC_CHECK_MEMBERS([struct sysinfo.totalram], [], [], [#include <sys/sysinfo.h>])
AC_CHECK_DECLS([sysctl, CTL_HW, HW_PHYSMEM], [], [], [#include <sys/sysctl.h>])
AM_INIT_AUTOMAKE([-Wall tar-pax foreign])
AC_CONFIG_FILES([Makefile
src/Makefile])
AC_OUTPUT
# dump some configuration confirmations
echo \
"
-- ${PACKAGE_STRING} Configuration Results --
C++ compiler: ${CXX} ${CXXFLAGS} ${LDFLAGS}"
if test x"${GCC}" = x"yes" ; then
gcc_version=`${CC} --version | head -n 1`
echo " GCC version: ${gcc_version}"
else
gcc_version=''
fi
echo \
" Host System type: ${host}
Install prefix: ${prefix}
Install eprefix: ${exec_prefix}
See config.h for further configuration information.
Email <${PACKAGE_BUGREPORT}> with questions and bug reports.
"
if test x"${PYTHON}" = x":" || ! test -x "${PYTHON}"; then
echo "WARNING! python was not found and is required to run some utility scripts"
echo " We recommend installing python and pointing configure to the installed location"
fi
================================================
FILE: cufflinks.xcodeproj/cole.pbxuser
================================================
// !$*UTF8*$!
{
08FB7793FE84155DC02AAC07 /* Project object */ = {
activeArchitecturePreference = x86_64;
activeBuildConfigurationName = Debug;
activeExecutable = EDD0CD9D10C72AC200AF308F /* cufflinks */;
activeTarget = 8DD76F620486A84900D96B5E /* cufflinks */;
addToTargets = (
EDFE39B0122BE65600F24CD3 /* cuffcluster */,
);
breakpoints = (
ED0E3F3F12CBA86F00074D2E /* sorting_hat.cpp:725 */,
ED0E3F4312CBA89F00074D2E /* sorting_hat.cpp:735 */,
EDC57AC912F7D53300493081 /* cufflinks.cpp:483 */,
EDC57ACD12F7D56A00493081 /* scaffolds.cpp:539 */,
EDC57AE812F8578000493081 /* cufflinks.cpp:543 */,
EDC57AEE12F857FF00493081 /* filters.cpp:506 */,
EDDC69AA1304DCE000637B75 /* cuffdiff.cpp:435 */,
EDDC69BF1304DEF800637B75 /* cuffdiff.cpp:458 */,
EDDC69C51304DF9000637B75 /* cuffdiff.cpp:452 */,
EDDC69D41304E09600637B75 /* differential.cpp:28 */,
EDDC69EC1304E2C600637B75 /* differential.cpp:35 */,
EDC583B21308455A0013090E /* cufflinks.cpp:646 */,
EDC583C0130847140013090E /* filters.cpp:867 */,
EDC583CA130853530013090E /* filters.cpp:897 */,
EDC583F41308558F0013090E /* filters.cpp:936 */,
EDC583FF130855D10013090E /* filters.cpp:927 */,
EDC58405130856060013090E /* filters.cpp:916 */,
EDC5840D130856B00013090E /* filters.cpp:931 */,
EDC5843C130859F80013090E /* filters.cpp:894 */,
EDC5844A13085AD90013090E /* filters.cpp:930 */,
EDC5845C13085BDA0013090E /* filters.cpp:912 */,
EDC584A8130863A20013090E /* filters.cpp:985 */,
EDC584AC130863FE0013090E /* filters.cpp:992 */,
);
codeSenseManager = EDA5150110C72929000A4F41 /* Code sense */;
executables = (
EDD0CD9D10C72AC200AF308F /* cufflinks */,
EDD0CE2310C72F7D00AF308F /* cuffdiff */,
EDD6A9D611598ABA00D3F668 /* cuffcompare */,
EDD6AA241159BA2E00D3F668 /* Unit Tests */,
EDD94CD31208E48B00AA1086 /* gtf_to_sam */,
EDFE39CF122BE65600F24CD3 /* cuffcluster */,
ED41B839127602C60000B5A2 /* gtf_reads */,
);
perUserDictionary = {
"PBXConfiguration.PBXBreakpointsDataSource.v1:1CA23EDF0692099D00951B8B" = {
PBXFileTableDataSourceColumnSortingDirectionKey = "-1";
PBXFileTableDataSourceColumnSortingKey = PBXBreakpointsDataSource_BreakpointID;
PBXFileTableDataSourceColumnWidthsKey = (
20,
20,
165,
20,
165,
165,
165,
20,
);
PBXFileTableDataSourceColumnsKey = (
PBXBreakpointsDataSource_ActionID,
PBXBreakpointsDataSource_TypeID,
PBXBreakpointsDataSource_BreakpointID,
PBXBreakpointsDataSource_UseID,
PBXBreakpointsDataSource_LocationID,
PBXBreakpointsDataSource_ConditionID,
PBXBreakpointsDataSource_IgnoreCountID,
PBXBreakpointsDataSource_ContinueID,
);
};
PBXConfiguration.PBXFileTableDataSource3.PBXExecutablesDataSource = {
PBXFileTableDataSourceColumnSortingDirectionKey = "-1";
PBXFileTableDataSourceColumnSortingKey = PBXExecutablesDataSource_NameID;
PBXFileTableDataSourceColumnWidthsKey = (
22,
300,
372,
);
PBXFileTableDataSourceColumnsKey = (
PBXExecutablesDataSource_ActiveFlagID,
PBXExecutablesDataSource_NameID,
PBXExecutablesDataSource_CommentsID,
);
};
PBXConfiguration.PBXFileTableDataSource3.PBXFileTableDataSource = {
PBXFileTableDataSourceColumnSortingDirectionKey = "-1";
PBXFileTableDataSourceColumnSortingKey = PBXFileDataSource_Filename_ColumnID;
PBXFileTableDataSourceColumnWidthsKey = (
20,
484,
20,
48,
43,
43,
20,
);
PBXFileTableDataSourceColumnsKey = (
PBXFileDataSource_FiletypeID,
PBXFileDataSource_Filename_ColumnID,
PBXFileDataSource_Built_ColumnID,
PBXFileDataSource_ObjectSize_ColumnID,
PBXFileDataSource_Errors_ColumnID,
PBXFileDataSource_Warnings_ColumnID,
PBXFileDataSource_Target_ColumnID,
);
};
PBXConfiguration.PBXFileTableDataSource3.PBXFindDataSource = {
PBXFileTableDataSourceColumnSortingDirectionKey = "-1";
PBXFileTableDataSourceColumnSortingKey = PBXFindDataSource_LocationID;
PBXFileTableDataSourceColumnWidthsKey = (
200,
750.20849609375,
);
PBXFileTableDataSourceColumnsKey = (
PBXFindDataSource_MessageID,
PBXFindDataSource_LocationID,
);
};
PBXConfiguration.PBXFileTableDataSource3.PBXSymbolsDataSource = {
PBXFileTableDataSourceColumnSortingDirectionKey = "-1";
PBXFileTableDataSourceColumnSortingKey = PBXSymbolsDataSource_SymbolNameID;
PBXFileTableDataSourceColumnWidthsKey = (
16,
200,
50,
513,
);
PBXFileTableDataSourceColumnsKey = (
PBXSymbolsDataSource_SymbolTypeIconID,
PBXSymbolsDataSource_SymbolNameID,
PBXSymbolsDataSource_SymbolTypeID,
PBXSymbolsDataSource_ReferenceNameID,
);
};
PBXConfiguration.PBXFileTableDataSource3.XCSCMDataSource = {
PBXFileTableDataSourceColumnSortingDirectionKey = "-1";
PBXFileTableDataSourceColumnSortingKey = PBXFileDataSource_Filename_ColumnID;
PBXFileTableDataSourceColumnWidthsKey = (
20,
20,
815,
20,
48.16259765625,
43,
43,
20,
);
PBXFileTableDataSourceColumnsKey = (
PBXFileDataSource_SCM_ColumnID,
PBXFileDataSource_FiletypeID,
PBXFileDataSource_Filename_ColumnID,
PBXFileDataSource_Built_ColumnID,
PBXFileDataSource_ObjectSize_ColumnID,
PBXFileDataSource_Errors_ColumnID,
PBXFileDataSource_Warnings_ColumnID,
PBXFileDataSource_Target_ColumnID,
);
};
PBXConfiguration.PBXTargetDataSource.PBXTargetDataSource = {
PBXFileTableDataSourceColumnSortingDirectionKey = "-1";
PBXFileTableDataSourceColumnSortingKey = PBXFileDataSource_Filename_ColumnID;
PBXFileTableDataSourceColumnWidthsKey = (
20,
510,
60,
20,
48,
43,
43,
);
PBXFileTableDataSourceColumnsKey = (
PBXFileDataSource_FiletypeID,
PBXFileDataSource_Filename_ColumnID,
PBXTargetDataSource_PrimaryAttribute,
PBXFileDataSource_Built_ColumnID,
PBXFileDataSource_ObjectSize_ColumnID,
PBXFileDataSource_Errors_ColumnID,
PBXFileDataSource_Warnings_ColumnID,
);
};
PBXPerProjectTemplateStateSaveDate = 319308049;
PBXWorkspaceStateSaveDate = 319308049;
};
perUserProjectItems = {
ED0E3EF212CB949000074D2E /* PBXTextBookmark */ = ED0E3EF212CB949000074D2E /* PBXTextBookmark */;
ED0E3F0712CB97B000074D2E /* PBXTextBookmark */ = ED0E3F0712CB97B000074D2E /* PBXTextBookmark */;
ED291363122D32B500C3703E /* PBXTextBookmark */ = ED291363122D32B500C3703E /* PBXTextBookmark */;
ED48339D12400ED100642337 /* PBXTextBookmark */ = ED48339D12400ED100642337 /* PBXTextBookmark */;
ED48351812415CA300642337 /* PBXTextBookmark */ = ED48351812415CA300642337 /* PBXTextBookmark */;
ED4835AE12481D1900642337 /* PBXTextBookmark */ = ED4835AE12481D1900642337 /* PBXTextBookmark */;
ED70726B11F79D170028F305 /* PBXTextBookmark */ = ED70726B11F79D170028F305 /* PBXTextBookmark */;
ED78C54112F52C6E00111993 /* PBXTextBookmark */ = ED78C54112F52C6E00111993 /* PBXTextBookmark */;
ED79DB8512A49C3400ABC8B3 /* PBXTextBookmark */ = ED79DB8512A49C3400ABC8B3 /* PBXTextBookmark */;
ED79DC1E12AC5D4E00ABC8B3 /* PBXTextBookmark */ = ED79DC1E12AC5D4E00ABC8B3 /* PBXTextBookmark */;
ED79DC9912AC5F1A00ABC8B3 /* PBXTextBookmark */ = ED79DC9912AC5F1A00ABC8B3 /* PBXTextBookmark */;
ED79DC9B12AC5F1A00ABC8B3 /* PBXTextBookmark */ = ED79DC9B12AC5F1A00ABC8B3 /* PBXTextBookmark */;
ED79DCB212AC629D00ABC8B3 /* PBXTextBookmark */ = ED79DCB212AC629D00ABC8B3 /* PBXTextBookmark */;
ED7CFAE71294286100DB052B /* PBXTextBookmark */ = ED7CFAE71294286100DB052B /* PBXTextBookmark */;
ED7CFAEA1294286100DB052B /* PBXTextBookmark */ = ED7CFAEA1294286100DB052B /* PBXTextBookmark */;
EDA5B99312F6599F005AEC09 /* PBXTextBookmark */ = EDA5B99312F6599F005AEC09 /* PBXTextBookmark */;
EDAE42851298369000F35B48 /* PBXTextBookmark */ = EDAE42851298369000F35B48 /* PBXTextBookmark */;
EDBBA10211DA433F0015175B /* PBXTextBookmark */ = EDBBA10211DA433F0015175B /* PBXTextBookmark */;
EDBBA3FA11DD8E140015175B /* PBXTextBookmark */ = EDBBA3FA11DD8E140015175B /* PBXTextBookmark */;
EDBCDD4B1235E4090050A8E4 /* PBXTextBookmark */ = EDBCDD4B1235E4090050A8E4 /* PBXTextBookmark */;
EDBCDD4D1235E4090050A8E4 /* PBXTextBookmark */ = EDBCDD4D1235E4090050A8E4 /* PBXTextBookmark */;
EDBCDDFB1235EEB60050A8E4 /* PBXTextBookmark */ = EDBCDDFB1235EEB60050A8E4 /* PBXTextBookmark */;
EDBCDDFC1235EEB60050A8E4 /* PBXTextBookmark */ = EDBCDDFC1235EEB60050A8E4 /* PBXTextBookmark */;
EDBCDF80123721790050A8E4 /* PBXTextBookmark */ = EDBCDF80123721790050A8E4 /* PBXTextBookmark */;
EDC57A9512F7CC9F00493081 /* PBXTextBookmark */ = EDC57A9512F7CC9F00493081 /* PBXTextBookmark */;
EDC57AE012F7D66C00493081 /* PBXTextBookmark */ = EDC57AE012F7D66C00493081 /* PBXTextBookmark */;
EDC57AF312F8580200493081 /* PBXTextBookmark */ = EDC57AF312F8580200493081 /* PBXTextBookmark */;
EDC57AF612F8580200493081 /* PBXTextBookmark */ = EDC57AF612F8580200493081 /* PBXTextBookmark */;
EDC57B0C12F859B500493081 /* PBXTextBookmark */ = EDC57B0C12F859B500493081 /* PBXTextBookmark */;
EDC57B1212F85B6E00493081 /* PBXTextBookmark */ = EDC57B1212F85B6E00493081 /* PBXTextBookmark */;
EDC58391130833E90013090E /* PBXTextBookmark */ = EDC58391130833E90013090E /* PBXTextBookmark */;
EDC58392130833E90013090E /* PBXTextBookmark */ = EDC58392130833E90013090E /* PBXTextBookmark */;
EDC58393130833E90013090E /* PBXTextBookmark */ = EDC58393130833E90013090E /* PBXTextBookmark */;
EDC58394130833E90013090E /* PBXTextBookmark */ = EDC58394130833E90013090E /* PBXTextBookmark */;
EDC583B6130845640013090E /* PBXTextBookmark */ = EDC583B6130845640013090E /* PBXTextBookmark */;
EDC583B7130845640013090E /* PBXTextBookmark */ = EDC583B7130845640013090E /* PBXTextBookmark */;
EDC583F0130855740013090E /* PBXTextBookmark */ = EDC583F0130855740013090E /* PBXTextBookmark */;
EDC584BD130865E80013090E /* PBXTextBookmark */ = EDC584BD130865E80013090E /* PBXTextBookmark */;
EDC584C5130866820013090E /* PBXTextBookmark */ = EDC584C5130866820013090E /* PBXTextBookmark */;
EDC584C6130866820013090E /* PBXTextBookmark */ = EDC584C6130866820013090E /* PBXTextBookmark */;
EDC584C7130866820013090E /* XCBuildMessageTextBookmark */ = EDC584C7130866820013090E /* XCBuildMessageTextBookmark */;
EDC584C913087F870013090E /* PBXTextBookmark */ = EDC584C913087F870013090E /* PBXTextBookmark */;
EDDBF71412D2BD4400130D8A /* PBXTextBookmark */ = EDDBF71412D2BD4400130D8A /* PBXTextBookmark */;
EDDBF71512D2BD4400130D8A /* PBXTextBookmark */ = EDDBF71512D2BD4400130D8A /* PBXTextBookmark */;
EDDC69911304DBC100637B75 /* PBXTextBookmark */ = EDDC69911304DBC100637B75 /* PBXTextBookmark */;
EDDC69F01304E2FC00637B75 /* PBXTextBookmark */ = EDDC69F01304E2FC00637B75 /* PBXTextBookmark */;
EDFDE77312BEA9100044EDD0 /* PBXTextBookmark */ = EDFDE77312BEA9100044EDD0 /* PBXTextBookmark */;
EDFDE78F12BEACA20044EDD0 /* PBXTextBookmark */ = EDFDE78F12BEACA20044EDD0 /* PBXTextBookmark */;
EDFE393512299AE500F24CD3 /* PBXTextBookmark */ = EDFE393512299AE500F24CD3 /* PBXTextBookmark */;
EDFE3A0C122BE93000F24CD3 /* PBXTextBookmark */ = EDFE3A0C122BE93000F24CD3 /* PBXTextBookmark */;
EDFE3A0D122BE93000F24CD3 /* PBXTextBookmark */ = EDFE3A0D122BE93000F24CD3 /* PBXTextBookmark */;
EDFE3A5B122C04D700F24CD3 /* PBXTextBookmark */ = EDFE3A5B122C04D700F24CD3 /* PBXTextBookmark */;
};
sourceControlManager = EDA5150010C72929000A4F41 /* Source Control */;
userBuildSettings = {
};
};
0A5D9A35123B5BE0002BEFD5 /* GFastaIndex.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1084, 2197}}";
sepNavSelRange = "{1068, 0}";
sepNavVisRange = "{0, 1544}";
};
};
0A5D9A3F123B5BFE002BEFD5 /* GFastaIndex.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1084, 1196}}";
sepNavSelRange = "{0, 0}";
sepNavVisRange = "{0, 824}";
};
};
0ACD78C612E6647B00310E07 /* update_check.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1475, 1248}}";
sepNavSelRange = "{2052, 32}";
sepNavVisRange = "{1052, 1451}";
};
};
8DD76F620486A84900D96B5E /* cufflinks */ = {
activeExec = 0;
executables = (
EDD0CD9D10C72AC200AF308F /* cufflinks */,
);
};
ED0E3ED812CB937D00074D2E /* stl_iterator_base_types.h */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.c.h;
name = stl_iterator_base_types.h;
path = "/Developer/SDKs/MacOSX10.6.sdk/usr/include/c++/4.2.1/bits/stl_iterator_base_types.h";
sourceTree = "<absolute>";
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1002, 2210}}";
sepNavSelRange = "{4481, 0}";
sepNavVisRange = "{4047, 936}";
};
};
ED0E3EF212CB949000074D2E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = ED0E3ED812CB937D00074D2E /* stl_iterator_base_types.h */;
name = "stl_iterator_base_types.h: 84";
rLen = 0;
rLoc = 3524;
rType = 0;
vrLen = 1922;
vrLoc = 2559;
};
ED0E3F0712CB97B000074D2E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5151E10C72963000A4F41 /* abundances.cpp */;
name = "abundances.cpp: 363";
rLen = 45;
rLoc = 7849;
rType = 0;
vrLen = 1563;
vrLoc = 7505;
};
ED0E3F3F12CBA86F00074D2E /* sorting_hat.cpp:725 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDFE39AF122BE4F400F24CD3 /* sorting_hat.cpp */;
functionName = "driver(FILE* fpkm_file, FILE* spec_out, FILE* row_matrix_out, FILE* row_density_out)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 725;
location = cufflinks_xcode;
modificationTime = 319317165.204594;
originalNumberOfMultipleMatches = 1;
state = 2;
};
ED0E3F4312CBA89F00074D2E /* sorting_hat.cpp:735 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDFE39AF122BE4F400F24CD3 /* sorting_hat.cpp */;
functionName = "driver(FILE* fpkm_file, FILE* spec_out, FILE* row_matrix_out, FILE* row_density_out)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 735;
location = cufflinks_xcode;
modificationTime = 319317165.205203;
originalNumberOfMultipleMatches = 1;
state = 2;
};
ED1C0C7111D7D9E500CFD663 /* ax_boost_base.m4 */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {3064, 2860}}";
sepNavSelRange = "{3845, 13}";
sepNavVisRange = "{2759, 1708}";
};
};
ED1C0C7211D7D9E500CFD663 /* ax_boost_thread.m4 */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1860, 1872}}";
sepNavSelRange = "{4519, 26}";
sepNavVisRange = "{0, 1482}";
};
};
ED1C0C7411D7DA3200CFD663 /* ax_bam.m4 */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {2952, 2704}}";
sepNavSelRange = "{6426, 4}";
sepNavVisRange = "{5471, 1174}";
};
};
ED1C0CAA11D7E52400CFD663 /* ax_check_zlib.m4 */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {943, 1651}}";
sepNavSelRange = "{4111, 0}";
sepNavVisRange = "{2926, 1646}";
};
};
ED291363122D32B500C3703E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = ED291364122D32B500C3703E /* bind.hpp */;
name = "bind.hpp: 306";
rLen = 0;
rLoc = 7929;
rType = 0;
vrLen = 1655;
vrLoc = 7187;
};
ED291364122D32B500C3703E /* bind.hpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.h;
name = bind.hpp;
path = "/usr/local/include/boost-1_41/boost/bind/bind.hpp";
sourceTree = "<absolute>";
};
ED41B816127602C60000B5A2 /* gtf_reads */ = {
activeExec = 0;
executables = (
ED41B839127602C60000B5A2 /* gtf_reads */,
);
};
ED41B839127602C60000B5A2 /* gtf_reads */ = {
isa = PBXExecutable;
activeArgIndices = (
);
argumentStrings = (
);
autoAttachOnCrash = 1;
breakpointsEnabled = 0;
configStateDict = {
};
customDataFormattersEnabled = 1;
dataTipCustomDataFormattersEnabled = 1;
dataTipShowTypeColumn = 1;
dataTipSortType = 0;
debuggerPlugin = GDBDebugging;
disassemblyDisplayState = 0;
dylibVariantSuffix = "";
enableDebugStr = 1;
environmentEntries = (
);
executableSystemSymbolLevel = 0;
executableUserSymbolLevel = 0;
libgmallocEnabled = 0;
name = gtf_reads;
showTypeColumn = 0;
sourceDirectories = (
);
};
ED48339D12400ED100642337 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5150C10C72963000A4F41 /* codons.h */;
name = "codons.h: 1";
rLen = 0;
rLoc = 0;
rType = 0;
vrLen = 795;
vrLoc = 0;
};
ED48351812415CA300642337 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5152F10C72963000A4F41 /* gtf_tracking.cpp */;
name = "gtf_tracking.cpp: 458";
rLen = 0;
rLoc = 15301;
rType = 0;
vrLen = 1332;
vrLoc = 14452;
};
ED4835AE12481D1900642337 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDE78A2C11B5F4F0000F8846 /* graph_optimize.cpp */;
name = "graph_optimize.cpp: 691";
rLen = 0;
rLoc = 18780;
rType = 0;
vrLen = 1336;
vrLoc = 2617;
};
ED4835D81249057500642337 /* progressbar.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {728, 1131}}";
sepNavSelRange = "{709, 8}";
sepNavVisRange = "{395, 757}";
};
};
ED70726B11F79D170028F305 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = ED70726C11F79D170028F305 /* vector_map.h */;
name = "vector_map.h: 152";
rLen = 0;
rLoc = 4673;
rType = 0;
vrLen = 921;
vrLoc = 4204;
};
ED70726C11F79D170028F305 /* vector_map.h */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.c.h;
name = vector_map.h;
path = /Users/cole/develop/cufflinks/src/lemon/bits/vector_map.h;
sourceTree = "<absolute>";
};
ED78C54112F52C6E00111993 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDDBF70912D29DF000130D8A /* cuffcluster.cpp */;
name = "cuffcluster.cpp: 793";
rLen = 0;
rLoc = 24115;
rType = 0;
vrLen = 1037;
vrLoc = 23577;
};
ED79DB8512A49C3400ABC8B3 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = ED4835D81249057500642337 /* progressbar.h */;
name = "progressbar.h: 39";
rLen = 8;
rLoc = 709;
rType = 0;
vrLen = 757;
vrLoc = 395;
};
ED79DC1E12AC5D4E00ABC8B3 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5153010C72963000A4F41 /* hits.cpp */;
name = "hits.cpp: 552";
rLen = 0;
rLoc = 13884;
rType = 0;
vrLen = 779;
vrLoc = 7836;
};
ED79DC9712AC5F0900ABC8B3 /* sp_counted_base_gcc_x86.hpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.h;
name = sp_counted_base_gcc_x86.hpp;
path = /Users/cole/boost_install/boost_1_41_0/./boost/smart_ptr/detail/sp_counted_base_gcc_x86.hpp;
sourceTree = "<absolute>";
};
ED79DC9912AC5F1A00ABC8B3 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = ED79DC9A12AC5F1A00ABC8B3 /* thread.cpp */;
name = "thread.cpp: 184";
rLen = 0;
rLoc = 6214;
rType = 0;
vrLen = 704;
vrLoc = 5786;
};
ED79DC9A12AC5F1A00ABC8B3 /* thread.cpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.cpp;
name = thread.cpp;
path = /Users/cole/boost_install/boost_1_41_0/libs/thread/src/pthread/thread.cpp;
sourceTree = "<absolute>";
};
ED79DC9B12AC5F1A00ABC8B3 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = ED79DC9C12AC5F1A00ABC8B3 /* thread.hpp */;
name = "thread.hpp: 184";
rLen = 0;
rLoc = 4934;
rType = 0;
vrLen = 569;
vrLoc = 4657;
};
ED79DC9C12AC5F1A00ABC8B3 /* thread.hpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.h;
name = thread.hpp;
path = /usr/local/include/boost/thread/detail/thread.hpp;
sourceTree = "<absolute>";
};
ED79DCB212AC629D00ABC8B3 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = ED79DC9712AC5F0900ABC8B3 /* sp_counted_base_gcc_x86.hpp */;
name = "sp_counted_base_gcc_x86.hpp: 132";
rLen = 0;
rLoc = 2701;
rType = 0;
vrLen = 643;
vrLoc = 2613;
};
ED79DCDB12AC63F200ABC8B3 /* stl_vector.h */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.c.h;
name = stl_vector.h;
path = "/Developer/SDKs/MacOSX10.6.sdk/usr/include/c++/4.2.1/bits/stl_vector.h";
sourceTree = "<absolute>";
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1002, 12766}}";
sepNavSelRange = "{16871, 0}";
sepNavVisRange = "{16542, 887}";
};
};
ED7CFAE71294286100DB052B /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = ED7CFAE81294286100DB052B /* exceptions.hpp */;
name = "exceptions.hpp: 87";
rLen = 53;
rLoc = 2928;
rType = 0;
vrLen = 1216;
vrLoc = 2223;
};
ED7CFAE81294286100DB052B /* exceptions.hpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.h;
name = exceptions.hpp;
path = "/usr/local/include/boost-1_41/boost/format/exceptions.hpp";
sourceTree = "<absolute>";
};
ED7CFAEA1294286100DB052B /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDBAC4C011FF5AD3002B7162 /* biascorrection.h */;
name = "biascorrection.h: 71";
rLen = 0;
rLoc = 2034;
rType = 0;
vrLen = 1171;
vrLoc = 1468;
};
EDA5150010C72929000A4F41 /* Source Control */ = {
isa = PBXSourceControlManager;
fallbackIsa = XCSourceControlManager;
isSCMEnabled = 0;
scmConfiguration = {
repositoryNamesForRoots = {
"" = "SR Trac";
};
};
};
EDA5150110C72929000A4F41 /* Code sense */ = {
isa = PBXCodeSenseManager;
indexTemplatePath = "";
};
EDA5150910C72963000A4F41 /* abundances.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1118, 6045}}";
sepNavSelRange = "{4600, 9}";
sepNavVisRange = "{3906, 1089}";
};
};
EDA5150A10C72963000A4F41 /* assemble.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {654, 650}}";
sepNavSelRange = "{0, 0}";
sepNavVisRange = "{0, 844}";
};
};
EDA5150B10C72963000A4F41 /* bundles.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1020, 8632}}";
sepNavSelRange = "{2226, 0}";
sepNavVisRange = "{1684, 1237}";
};
};
EDA5150C10C72963000A4F41 /* codons.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1084, 663}}";
sepNavSelRange = "{0, 0}";
sepNavVisRange = "{0, 795}";
};
};
EDA5150D10C72963000A4F41 /* common.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {852, 3640}}";
sepNavSelRange = "{7402, 0}";
sepNavVisRange = "{5413, 1998}";
};
};
EDA5150E10C72963000A4F41 /* filters.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {662, 585}}";
sepNavSelRange = "{928, 5}";
sepNavVisRange = "{0, 968}";
};
};
EDA5151010C72963000A4F41 /* GBase.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1132, 5473}}";
sepNavSelRange = "{7541, 0}";
sepNavVisRange = "{7070, 1033}";
};
};
EDA5151210C72963000A4F41 /* genes.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1132, 2028}}";
sepNavSelRange = "{800, 15}";
sepNavVisRange = "{245, 1229}";
};
};
EDA5151310C72963000A4F41 /* GFaSeqGet.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {861, 1391}}";
sepNavSelRange = "{1468, 12}";
sepNavVisRange = "{1179, 919}";
};
};
EDA5151510C72963000A4F41 /* gff.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {747, 11011}}";
sepNavSelRange = "{8355, 6}";
sepNavVisRange = "{7906, 1526}";
};
};
EDA5151710C72963000A4F41 /* gtf_tracking.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {705, 15639}}";
sepNavSelRange = "{23139, 3}";
sepNavVisRange = "{85, 950}";
};
};
EDA5151810C72963000A4F41 /* hits.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {845, 12480}}";
sepNavSelRange = "{3093, 8}";
sepNavVisRange = "{2587, 821}";
sepNavWindowFrame = "{{15, 615}, {750, 558}}";
};
};
EDA5151910C72963000A4F41 /* scaffolds.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {662, 8749}}";
sepNavSelRange = "{4712, 6}";
sepNavVisRange = "{4559, 841}";
};
};
EDA5151A10C72963000A4F41 /* tokenize.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {845, 719}}";
sepNavSelRange = "{380, 0}";
sepNavVisRange = "{0, 417}";
};
};
EDA5151B10C72963000A4F41 /* transitive_closure.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {845, 5096}}";
sepNavSelRange = "{4199, 5}";
sepNavVisRange = "{3205, 1910}";
};
};
EDA5151C10C72963000A4F41 /* GHash.hh */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {662, 6565}}";
sepNavSelRange = "{4533, 5}";
sepNavVisRange = "{3766, 1765}";
};
};
EDA5151D10C72963000A4F41 /* GList.hh */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1132, 14742}}";
sepNavSelRange = "{20676, 0}";
sepNavVisRange = "{20108, 862}";
};
};
EDA5151E10C72963000A4F41 /* abundances.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {880, 25415}}";
sepNavSelRange = "{7849, 45}";
sepNavVisRange = "{7505, 1563}";
};
};
EDA5151F10C72963000A4F41 /* assemble.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {951, 7644}}";
sepNavSelRange = "{4744, 36}";
sepNavVisRange = "{5633, 728}";
sepNavWindowFrame = "{{56, 0}, {1224, 778}}";
};
};
EDA5152010C72963000A4F41 /* bundles.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1017, 20930}}";
sepNavSelRange = "{4607, 0}";
sepNavVisRange = "{4608, 683}";
};
};
EDA5152110C72963000A4F41 /* codons.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {845, 962}}";
sepNavSelRange = "{0, 0}";
sepNavVisRange = "{0, 3657}";
};
};
EDA5152210C72963000A4F41 /* common.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {866, 4576}}";
sepNavSelRange = "{798, 0}";
sepNavVisRange = "{410, 1245}";
};
};
EDA5152310C72963000A4F41 /* cuffcompare.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1167, 32825}}";
sepNavSelRange = "{11662, 0}";
sepNavVisRange = "{10667, 2154}";
};
};
EDA5152410C72963000A4F41 /* cuffdiff.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1216, 16562}}";
sepNavSelRange = "{13672, 19}";
sepNavVisRange = "{13345, 770}";
};
};
EDA5152510C72963000A4F41 /* cufflinks.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1002, 17082}}";
sepNavSelRange = "{20436, 0}";
sepNavVisRange = "{0, 638}";
};
};
EDA5152610C72963000A4F41 /* filters.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {880, 13338}}";
sepNavSelRange = "{28447, 0}";
sepNavVisRange = "{27593, 1534}";
};
};
EDA5152710C72963000A4F41 /* GArgs.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {939, 3367}}";
sepNavSelRange = "{0, 0}";
sepNavVisRange = "{115, 1213}";
};
};
EDA5152810C72963000A4F41 /* GBase.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {846, 8008}}";
sepNavSelRange = "{449, 37}";
sepNavVisRange = "{353, 1048}";
};
};
EDA5152A10C72963000A4F41 /* genes.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1419, 1495}}";
sepNavSelRange = "{2215, 9}";
sepNavVisRange = "{408, 1088}";
};
};
EDA5152B10C72963000A4F41 /* GFaSeqGet.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {939, 3848}}";
sepNavSelRange = "{948, 12}";
sepNavVisRange = "{1858, 1226}";
};
};
EDA5152C10C72963000A4F41 /* gff.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {943, 17147}}";
sepNavSelRange = "{20913, 0}";
sepNavVisRange = "{20451, 902}";
};
};
EDA5152D10C72963000A4F41 /* GStr.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {859, 16757}}";
sepNavSelRange = "{0, 0}";
sepNavVisRange = "{0, 818}";
};
};
EDA5152E10C72963000A4F41 /* gtf_reads.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {670, 2353}}";
sepNavSelRange = "{2396, 0}";
sepNavVisRange = "{1704, 1284}";
};
};
EDA5152F10C72963000A4F41 /* gtf_tracking.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1084, 7748}}";
sepNavSelRange = "{15301, 0}";
sepNavVisRange = "{14452, 1332}";
};
};
EDA5153010C72963000A4F41 /* hits.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {859, 11713}}";
sepNavSelRange = "{13884, 0}";
sepNavVisRange = "{7836, 779}";
};
};
EDA5153110C72963000A4F41 /* scaffolds.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {951, 19591}}";
sepNavSelRange = "{37749, 0}";
sepNavVisRange = "{35854, 962}";
};
};
EDA5153210C72963000A4F41 /* tokenize.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {802, 764}}";
sepNavSelRange = "{0, 0}";
sepNavVisRange = "{0, 1223}";
};
};
EDA5B99312F6599F005AEC09 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDE78BC411B716C3000F8846 /* matching_merge.cpp */;
name = "matching_merge.cpp: 1";
rLen = 0;
rLoc = 0;
rType = 0;
vrLen = 773;
vrLoc = 0;
};
EDACE430114EFF5C009024DB /* differential.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {951, 3874}}";
sepNavSelRange = "{858, 24}";
sepNavVisRange = "{906, 696}";
};
};
EDACE431114EFF5C009024DB /* differential.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {782, 10322}}";
sepNavSelRange = "{771, 6}";
sepNavVisRange = "{478, 1424}";
};
};
EDACE438114F031B009024DB /* clustering.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1084, 1885}}";
sepNavSelRange = "{685, 0}";
sepNavVisRange = "{2026, 1419}";
};
};
EDACE439114F031B009024DB /* clustering.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {911, 1833}}";
sepNavSelRange = "{0, 0}";
sepNavVisRange = "{464, 988}";
};
};
EDAE42851298369000F35B48 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDBAC4BF11FF5AD3002B7162 /* biascorrection.cpp */;
name = "biascorrection.cpp: 669";
rLen = 0;
rLoc = 18761;
rType = 0;
vrLen = 1361;
vrLoc = 17949;
};
EDBAC4BF11FF5AD3002B7162 /* biascorrection.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {728, 10140}}";
sepNavSelRange = "{18761, 0}";
sepNavVisRange = "{17949, 1361}";
};
};
EDBAC4C011FF5AD3002B7162 /* biascorrection.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {845, 1287}}";
sepNavSelRange = "{2034, 0}";
sepNavVisRange = "{1468, 1171}";
};
};
EDBBA10211DA433F0015175B /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5151210C72963000A4F41 /* genes.h */;
name = "genes.h: 121";
rLen = 5;
rLoc = 2683;
rType = 0;
vrLen = 1027;
vrLoc = 2186;
};
EDBBA3FA11DD8E140015175B /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5153210C72963000A4F41 /* tokenize.cpp */;
name = "tokenize.cpp: 1";
rLen = 0;
rLoc = 0;
rType = 0;
vrLen = 1223;
vrLoc = 0;
};
EDBBE9C811AA3F5E006AC14A /* transitive_reduction.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {751, 1690}}";
sepNavSelRange = "{4405, 0}";
sepNavVisRange = "{876, 2560}";
};
};
EDBCDD4B1235E4090050A8E4 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDBCDD4C1235E4090050A8E4 /* checked_delete.hpp */;
name = "checked_delete.hpp: 34";
rLen = 0;
rLoc = 895;
rType = 0;
vrLen = 614;
vrLoc = 618;
};
EDBCDD4C1235E4090050A8E4 /* checked_delete.hpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.h;
name = checked_delete.hpp;
path = "/usr/local/include/boost-1_41/boost/checked_delete.hpp";
sourceTree = "<absolute>";
};
EDBCDD4D1235E4090050A8E4 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDBCDD4E1235E4090050A8E4 /* sp_counted_impl.hpp */;
name = "sp_counted_impl.hpp: 78";
rLen = 0;
rLoc = 1917;
rType = 0;
vrLen = 555;
vrLoc = 1679;
};
EDBCDD4E1235E4090050A8E4 /* sp_counted_impl.hpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.h;
name = sp_counted_impl.hpp;
path = "/usr/local/include/boost-1_41/boost/smart_ptr/detail/sp_counted_impl.hpp";
sourceTree = "<absolute>";
};
EDBCDDFB1235EEB60050A8E4 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDFE38AC12298E3400F24CD3 /* sp_counted_base_gcc_x86.hpp */;
name = "sp_counted_base_gcc_x86.hpp: 133";
rLen = 0;
rLoc = 2707;
rType = 0;
vrLen = 807;
vrLoc = 2328;
};
EDBCDDFC1235EEB60050A8E4 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDBEA60411EA75CD00C661A7 /* shared_count.hpp */;
name = "shared_count.hpp: 223";
rLen = 0;
rLoc = 4802;
rType = 0;
vrLen = 675;
vrLoc = 4534;
};
EDBCDF80123721790050A8E4 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5152810C72963000A4F41 /* GBase.cpp */;
name = "GBase.cpp: 15";
rLen = 37;
rLoc = 449;
rType = 0;
vrLen = 1048;
vrLoc = 353;
};
EDBEA60411EA75CD00C661A7 /* shared_count.hpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.h;
name = shared_count.hpp;
path = "/usr/local/include/boost-1_41/boost/smart_ptr/detail/shared_count.hpp";
sourceTree = "<absolute>";
};
EDBEA60611EA75CD00C661A7 /* stl_iterator.h */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.c.h;
name = stl_iterator.h;
path = "/Developer/SDKs/MacOSX10.6.sdk/usr/include/c++/4.2.1/bits/stl_iterator.h";
sourceTree = "<absolute>";
};
EDC57A9512F7CC9F00493081 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5151F10C72963000A4F41 /* assemble.cpp */;
name = "assemble.cpp: 201";
rLen = 36;
rLoc = 4744;
rType = 0;
vrLen = 1463;
vrLoc = 4729;
};
EDC57AC912F7D53300493081 /* cufflinks.cpp:483 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152510C72963000A4F41 /* cufflinks.cpp */;
functionName = "pseudohits_from_ref(vector<shared_ptr<Scaffold> >& ref_scaffs, vector<Scaffold>& pseudohits, int hit_len)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 483;
location = cufflinks;
modificationTime = 319317165.205485;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC57ACD12F7D56A00493081 /* scaffolds.cpp:539 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5153110C72963000A4F41 /* scaffolds.cpp */;
functionName = "Scaffold::sub_scaffold(Scaffold& sub_scaff, int g_left, int match_length)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 539;
location = cufflinks;
modificationTime = 319317165.205942;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC57AE012F7D66C00493081 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDC57AE112F7D66C00493081 /* shared_ptr.hpp */;
name = "shared_ptr.hpp: 418";
rLen = 0;
rLoc = 10346;
rType = 0;
vrLen = 750;
vrLoc = 9887;
};
EDC57AE112F7D66C00493081 /* shared_ptr.hpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.h;
name = shared_ptr.hpp;
path = /usr/local/include/boost/smart_ptr/shared_ptr.hpp;
sourceTree = "<absolute>";
};
EDC57AE812F8578000493081 /* cufflinks.cpp:543 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152510C72963000A4F41 /* cufflinks.cpp */;
functionName = "scaffolds_for_bundle(const HitBundle& bundle, vector<shared_ptr<Scaffold> >& scaffolds, vector<shared_ptr<Scaffold> >* ref_scaffs = NULL, BundleStats* stats = NULL)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 543;
location = cufflinks;
modificationTime = 319317165.206342;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC57AEE12F857FF00493081 /* filters.cpp:506 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "filter_hits(int bundle_length, int bundle_left, vector<Scaffold>& hits)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 506;
location = cufflinks;
modificationTime = 319317165.206833;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC57AF312F8580200493081 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDBEA60611EA75CD00C661A7 /* stl_iterator.h */;
name = "stl_iterator.h: 653";
rLen = 0;
rLoc = 20926;
rType = 0;
vrLen = 1260;
vrLoc = 20301;
};
EDC57AF612F8580200493081 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5150B10C72963000A4F41 /* bundles.h */;
name = "bundles.h: 82";
rLen = 0;
rLoc = 2226;
rType = 0;
vrLen = 1237;
vrLoc = 1684;
};
EDC57B0C12F859B500493081 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5151910C72963000A4F41 /* scaffolds.h */;
name = "scaffolds.h: 204";
rLen = 6;
rLoc = 4712;
rType = 0;
vrLen = 841;
vrLoc = 4559;
};
EDC57B1212F85B6E00493081 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5153110C72963000A4F41 /* scaffolds.cpp */;
name = "scaffolds.cpp: 1417";
rLen = 0;
rLoc = 36434;
rType = 0;
vrLen = 1537;
vrLoc = 36099;
};
EDC58391130833E90013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDACE431114EFF5C009024DB /* differential.cpp */;
name = "differential.cpp: 35";
rLen = 6;
rLoc = 771;
rType = 0;
vrLen = 1424;
vrLoc = 478;
};
EDC58392130833E90013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = 0ACD78C612E6647B00310E07 /* update_check.h */;
name = "update_check.h: 86";
rLen = 32;
rLoc = 2052;
rType = 0;
vrLen = 1451;
vrLoc = 1052;
};
EDC58393130833E90013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5151510C72963000A4F41 /* gff.h */;
name = "gff.h: 328";
rLen = 6;
rLoc = 8355;
rType = 0;
vrLen = 1526;
vrLoc = 7906;
};
EDC58394130833E90013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5152310C72963000A4F41 /* cuffcompare.cpp */;
rLen = 11;
rLoc = 11530;
rType = 0;
};
EDC583B21308455A0013090E /* cufflinks.cpp:646 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152510C72963000A4F41 /* cufflinks.cpp */;
functionName = "scaffolds_for_bundle(const HitBundle& bundle, vector<shared_ptr<Scaffold> >& scaffolds, vector<shared_ptr<Scaffold> >* ref_scaffs = NULL, BundleStats* stats = NULL)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 646;
location = cufflinks;
modificationTime = 319317165.208697;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC583B6130845640013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5150E10C72963000A4F41 /* filters.h */;
name = "filters.h: 39";
rLen = 5;
rLoc = 928;
rType = 0;
vrLen = 968;
vrLoc = 0;
};
EDC583B7130845640013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5151C10C72963000A4F41 /* GHash.hh */;
name = "GHash.hh: 108";
rLen = 5;
rLoc = 4533;
rType = 0;
vrLen = 1765;
vrLoc = 3766;
};
EDC583C0130847140013090E /* filters.cpp:867 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 867;
location = cufflinks;
modificationTime = 319317165.209119;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC583CA130853530013090E /* filters.cpp:897 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 897;
location = cufflinks;
modificationTime = 319317165.209418;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC583F0130855740013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = ED79DCDB12AC63F200ABC8B3 /* stl_vector.h */;
name = "stl_vector.h: 478";
rLen = 0;
rLoc = 16903;
rType = 0;
vrLen = 1624;
vrLoc = 16136;
};
EDC583F41308558F0013090E /* filters.cpp:936 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 936;
location = cufflinks;
modificationTime = 319317165.209702;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC583FF130855D10013090E /* filters.cpp:927 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 927;
location = cufflinks;
modificationTime = 319317165.210135;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC58405130856060013090E /* filters.cpp:916 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 916;
location = cufflinks;
modificationTime = 319317165.210451;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC5840D130856B00013090E /* filters.cpp:931 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 931;
location = cufflinks;
modificationTime = 319317165.210683;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC5843C130859F80013090E /* filters.cpp:894 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 894;
location = cufflinks;
modificationTime = 319317165.210957;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC5844A13085AD90013090E /* filters.cpp:930 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 930;
location = cufflinks;
modificationTime = 319317165.211209;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC5845C13085BDA0013090E /* filters.cpp:912 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 912;
location = cufflinks;
modificationTime = 319317165.21152;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC584A8130863A20013090E /* filters.cpp:985 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 985;
location = cufflinks;
modificationTime = 319317165.211774;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC584AC130863FE0013090E /* filters.cpp:992 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152610C72963000A4F41 /* filters.cpp */;
functionName = "clip_by_3_prime_dropoff(Scaffold& scaff)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 992;
location = cufflinks;
modificationTime = 319317165.212033;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDC584BD130865E80013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5152610C72963000A4F41 /* filters.cpp */;
name = "filters.cpp: 965";
rLen = 0;
rLoc = 28447;
rType = 0;
vrLen = 1534;
vrLoc = 27593;
};
EDC584C5130866820013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5152210C72963000A4F41 /* common.cpp */;
name = "common.cpp: 46";
rLen = 0;
rLoc = 798;
rType = 0;
vrLen = 1245;
vrLoc = 410;
};
EDC584C6130866820013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5150D10C72963000A4F41 /* common.h */;
name = "common.h: 311";
rLen = 0;
rLoc = 7402;
rType = 0;
vrLen = 1998;
vrLoc = 5413;
};
EDC584C7130866820013090E /* XCBuildMessageTextBookmark */ = {
isa = PBXTextBookmark;
comments = "'OPT_3_PRIME_DROPOFF_FRAC' was not declared in this scope";
fRef = EDA5152510C72963000A4F41 /* cufflinks.cpp */;
fallbackIsa = XCBuildMessageTextBookmark;
rLen = 0;
rLoc = 293;
rType = 1;
};
EDC584C913087F870013090E /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5152510C72963000A4F41 /* cufflinks.cpp */;
name = "cufflinks.cpp: 294";
rLen = 0;
rLoc = 11409;
rType = 0;
vrLen = 1066;
vrLoc = 10672;
};
EDD0CD9D10C72AC200AF308F /* cufflinks */ = {
isa = PBXExecutable;
activeArgIndices = (
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
YES,
YES,
);
argumentStrings = (
"--max-mle-iterations 4",
"--num-importance-samples 100",
"-G MB8_plus_exons.cannonical_chr_names.gtf",
tsr.sam,
"-F 0.0",
"-j 0.25",
"-m 194",
Y3_FYB.sam,
"--output-dir test_dir",
"--collapse-thresh 30",
short.sam,
"-m 100",
"-j 0.05",
"-F 0.05",
nanog.sam,
Y4_IL7R.sam,
long.sam,
Tpm3.sam,
segfault.sam,
Th17_2_C6orf125.sam,
"-o perfect_abund -G mm9_chr123.gtf sim.sam",
"-s 40",
"-m 50",
large.sam,
"-G dmel-all-no-analysis-r5.12.no_ops_strand_exons.gtf",
tophat_out_090428_Graveley_lane2_accepted_hits.sam,
fixed.sam,
Fubp1.sam,
mega_bundle_2.sam,
Fhl3.sam,
Fn1.sam,
mega_bundle_1.sam,
Nek2.sam,
Lypla1.sam,
adipose_snippet.sam,
yyy.sam,
"-s 30",
adh_cluster.sam,
Pfkfb2.sam,
Lgtn.sam,
"-G gtf4.gtf",
delme7.sam,
tophat_out/accepted_hits.bam,
accepted_hits.bam,
chr1_307200_308260.no_splicing.sam,
chr1_307200_308260.sam,
PEchr1MinQV15_15e6.sam,
PEchr1MinQV15_15e6.bam,
"-o perfect_abund -G mm9_chr123.gtf -p 6 fixed.sam",
"-G sample.gtf",
"-s 4000",
"-i 10",
"-m 169",
"-m 165",
"-G SMTN_asm.gtf",
SMTN.bam,
"-M mask.gtf",
xxx.bam,
"--library-type solid-fragment",
/Volumes/Abel/wt.sr.bam,
"-j 0.05",
"-F 0.0",
"-F 0.0",
"Xist-breast.bam",
"Xist-ovary.bam",
"-o xxx",
"-G Homo_sapiens.GRCh37.58.name=id.gtf chr19.sam",
IgH.bam,
"-o perfect_abund -G mm9_chr123.gtf -p 1 sim.sam",
sim.sam,
"-G hg18-refGene.gtf",
assembly.sorted.bam,
"--overhang-tolerance 150",
xxx.sam,
SAMD11_NOC2L.bam,
"-F 0.0",
"-G mm9_chr123.gtf",
"-G small.gtf",
small.sam,
"-G ref_genes.gtf",
sim.bam,
sim.sam,
adh_cluster.sam,
"-j 0.0",
TMEM161B.bam,
AHNAK.sam,
ORM1_ORM2.bam,
tiny.sam,
"--min-frags-per-transfrag 15",
small_solid.bam,
NOC2L_solid.bam,
mega_bundle.bam,
xxx.sam,
chr1.top100k.blat.sam,
O16_18.trim.bam,
"--verbose",
"-G ginormous.100806.gtf header",
"--min-frags-per-transfrag 0",
"--min-intron-length 20",
atpase.sam,
alignments.sam,
deletions.sam,
DUF221_family_protein,
"--min-frags-per-transfrag 0",
"--library-type=fr-firststrand",
"CTCF-locus-H1-hESC-WC-PolyA-005WC+.sam",
yyy.sam,
"-A 0.0 -j 0.0 -F 0.0 --library-type=transfrags xxx.sam",
"-A 0.0 -j 0.0 -F 0.0 --library-type=transfrags allGTFsam_chr14.sam",
"-G chr19_metaAsm.gtf colon_chr19.2.bam\t",
"-G htt.gtf htt.sam",
"--GTF-guide 174mb.gtf 174mb.sam",
"--trim-3-avgcov-thresh 10000.0",
GNA12.bam,
);
autoAttachOnCrash = 1;
breakpointsEnabled = 1;
configStateDict = {
"PBXLSLaunchAction-0" = {
PBXLSLaunchAction = 0;
PBXLSLaunchStartAction = 1;
PBXLSLaunchStdioStyle = 2;
PBXLSLaunchStyle = 0;
class = PBXLSRunLaunchConfig;
commandLineArgs = (
);
displayName = "Executable Runner";
environment = {
};
identifier = com.apple.Xcode.launch.runConfig;
remoteHostInfo = "";
startActionInfo = "";
};
};
customDataFormattersEnabled = 1;
dataTipCustomDataFormattersEnabled = 1;
dataTipShowTypeColumn = 1;
dataTipSortType = 0;
debuggerPlugin = GDBDebugging;
disassemblyDisplayState = 0;
dylibVariantSuffix = "";
enableDebugStr = 1;
environmentEntries = (
);
executableSystemSymbolLevel = 0;
executableUserSymbolLevel = 0;
libgmallocEnabled = 0;
name = cufflinks;
savedGlobals = {
};
showTypeColumn = 0;
sourceDirectories = (
);
startupPath = /Users/cole/develop/cufflinks/tests/3prime_testing/hit_driven_0.5/GNA12;
variableFormatDictionary = {
};
};
EDD0CE0810C72F7D00AF308F /* cuffdiff */ = {
activeExec = 0;
executables = (
EDD0CE2310C72F7D00AF308F /* cuffdiff */,
);
};
EDD0CE2310C72F7D00AF308F /* cuffdiff */ = {
isa = PBXExecutable;
activeArgIndices = (
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
YES,
NO,
NO,
NO,
NO,
NO,
NO,
NO,
);
argumentStrings = (
"-c 10",
"--num-importance-samples 10000",
"--max-mle-iterations 4",
"-c 5000 ref_genes.gtf sim.sam sim.sam",
sample1/tophat_out/accepted_hits.sam,
sample2/tophat_out/accepted_hits.sam,
consensus.gtf,
Neu.gtf,
exp.sam,
60hr.sam,
5day.sam,
7day.sam,
"-o xxx_out",
SAA2.exon.gtf,
control1.sam,
control1.shadow.sam,
transcripts.gtf,
"SMTN.bam,SMTN.bam",
"SMTN.bam,SMTN.bam",
"mm9_chr123.gtf sim.sam,tmp/sim_replicate_1.sam tmp/sim_replicate_3.sam,tmp/sim_replicate_3.sam",
" -o YYY mm9_chr123.gtf xxx.sam xxx.sam",
"-p 1 mm9_chr123.gtf sim.sam tmp/sim_replicate_1.sam",
"-L rep1,rep2 -o replicate_diff -p 2 ref_genes.gtf sim.sam sim.sam",
"-c 0 --FDR 1.0 mm9_chr123.gtf xxx.sam xxx.sam",
"mm9_chr123.gtf sim.bam sim.bam",
"-p 2 -o replicate_diff mm9_chr123.gtf sim.sam tmp/sim_replicate_1.sam",
"tested_transcriptome.gtf sim.sam sim.sam",
"Ensembl.gtf adipose.bam.mitch.bam kidney.bam.mitch.bam",
"Ensembl.gtf adipose.bam.mitch.bam kidney.bam.mitch.bam skeletal-muscle.bam.mitch.bam adrenal.bam.mitch.bam liver.bam.mitch.bam testes.bam.mitch.bam brain.bam.mitch.bam lung.bam.mitch.bam thyroid.bam.mitch.bam breast.bam.mitch.bam lymph-node.bam.mitch.bam white-blood-cells.bam.mitch.bam colon.bam.mitch.bam ovary.bam.mitch.bam heart.bam.mitch.bam prostate.bam.mitch.bam",
"--min-alignment-count 100 Vkorc1.gtf BAT_D0_Vkorc1.bam BAT_D8_Vkorc1.bam",
"-c 100 AK079912.1.gtf AK079912_Sub_D0.bam AK079912_Sub_D8.bam",
);
autoAttachOnCrash = 1;
breakpointsEnabled = 1;
configStateDict = {
"PBXLSLaunchAction-0" = {
PBXLSLaunchAction = 0;
PBXLSLaunchStartAction = 1;
PBXLSLaunchStdioStyle = 2;
PBXLSLaunchStyle = 0;
class = PBXLSRunLaunchConfig;
commandLineArgs = (
);
displayName = "Executable Runner";
environment = {
};
identifier = com.apple.Xcode.launch.runConfig;
remoteHostInfo = "";
startActionInfo = "";
};
};
customDataFormattersEnabled = 1;
dataTipCustomDataFormattersEnabled = 1;
dataTipShowTypeColumn = 1;
dataTipSortType = 0;
debuggerPlugin = GDBDebugging;
disassemblyDisplayState = 0;
dylibVariantSuffix = "";
enableDebugStr = 1;
environmentEntries = (
);
executableSystemSymbolLevel = 0;
executableUserSymbolLevel = 0;
libgmallocEnabled = 0;
name = cuffdiff;
savedGlobals = {
};
showTypeColumn = 0;
sourceDirectories = (
);
startupPath = "/Users/cole/develop/simulations/RNA-Seq/mm9_small";
variableFormatDictionary = {
};
};
EDD6A7A0115562EE00D3F668 /* Makefile.am */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {662, 1820}}";
sepNavSelRange = "{2798, 0}";
sepNavVisRange = "{1957, 1171}";
};
};
EDD6A9BA11598AB900D3F668 /* cuffcompare */ = {
activeExec = 0;
executables = (
EDD6A9D611598ABA00D3F668 /* cuffcompare */,
);
};
EDD6A9D611598ABA00D3F668 /* cuffcompare */ = {
isa = PBXExecutable;
activeArgIndices = (
NO,
NO,
NO,
NO,
NO,
NO,
YES,
);
argumentStrings = (
"-r NCBI36.48.short.gtf",
NCBI36.48.short.gtf,
y1_short.gtf,
y2_short.gtf,
"-r MB8_plus_exons.cannonical_chr_names.gtf",
transcripts.gtf,
"-r gencode_v4.annotation.GRCh37.gtf -s ./ -o pooled -d 600 lymph-node.gtf",
);
autoAttachOnCrash = 1;
breakpointsEnabled = 1;
configStateDict = {
"PBXLSLaunchAction-0" = {
PBXLSLaunchAction = 0;
PBXLSLaunchStartAction = 1;
PBXLSLaunchStdioStyle = 2;
PBXLSLaunchStyle = 0;
class = PBXLSRunLaunchConfig;
commandLineArgs = (
);
displayName = "Executable Runner";
environment = {
};
identifier = com.apple.Xcode.launch.runConfig;
remoteHostInfo = "";
startActionInfo = "";
};
};
customDataFormattersEnabled = 1;
dataTipCustomDataFormattersEnabled = 1;
dataTipShowTypeColumn = 1;
dataTipSortType = 0;
debuggerPlugin = GDBDebugging;
disassemblyDisplayState = 0;
dylibVariantSuffix = "";
enableDebugStr = 1;
environmentEntries = (
);
executableSystemSymbolLevel = 0;
executableUserSymbolLevel = 0;
libgmallocEnabled = 0;
name = cuffcompare;
savedGlobals = {
};
showTypeColumn = 0;
sourceDirectories = (
);
startupPath = /Users/cole/tmp;
variableFormatDictionary = {
};
};
EDD6AA221159BA2E00D3F668 /* Unit Tests */ = {
activeExec = 0;
executables = (
EDD6AA241159BA2E00D3F668 /* Unit Tests */,
);
};
EDD6AA241159BA2E00D3F668 /* Unit Tests */ = {
isa = PBXExecutable;
activeArgIndices = (
);
argumentStrings = (
);
autoAttachOnCrash = 1;
breakpointsEnabled = 1;
configStateDict = {
};
customDataFormattersEnabled = 1;
dataTipCustomDataFormattersEnabled = 1;
dataTipShowTypeColumn = 1;
dataTipSortType = 0;
debuggerPlugin = GDBDebugging;
disassemblyDisplayState = 0;
dylibVariantSuffix = "";
enableDebugStr = 1;
environmentEntries = (
);
executableSystemSymbolLevel = 0;
executableUserSymbolLevel = 0;
libgmallocEnabled = 0;
name = "Unit Tests";
savedGlobals = {
};
showTypeColumn = 0;
sourceDirectories = (
);
};
EDD6AA461159BE6500D3F668 /* test_abundances.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {859, 358}}";
sepNavSelRange = "{147, 0}";
sepNavVisRange = "{0, 150}";
};
};
EDD6AA471159BE6500D3F668 /* test_main.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {914, 4615}}";
sepNavSelRange = "{1018, 0}";
sepNavVisRange = "{352, 1162}";
};
};
EDD94B461205C9E800AA1086 /* gtf_to_sam */ = {
activeExec = 0;
executables = (
EDD94CD31208E48B00AA1086 /* gtf_to_sam */,
);
};
EDD94B711205CAF400AA1086 /* gtf_to_sam.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1069, 3146}}";
sepNavSelRange = "{3814, 12}";
sepNavVisRange = "{3290, 801}";
};
};
EDD94CD31208E48B00AA1086 /* gtf_to_sam */ = {
isa = PBXExecutable;
activeArgIndices = (
);
argumentStrings = (
);
autoAttachOnCrash = 1;
breakpointsEnabled = 1;
configStateDict = {
};
customDataFormattersEnabled = 1;
dataTipCustomDataFormattersEnabled = 1;
dataTipShowTypeColumn = 1;
dataTipSortType = 0;
debuggerPlugin = GDBDebugging;
disassemblyDisplayState = 0;
dylibVariantSuffix = "";
enableDebugStr = 1;
environmentEntries = (
);
executableSystemSymbolLevel = 0;
executableUserSymbolLevel = 0;
libgmallocEnabled = 0;
name = gtf_to_sam;
savedGlobals = {
};
showTypeColumn = 0;
sourceDirectories = (
);
};
EDDBF70912D29DF000130D8A /* cuffcluster.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1090, 12142}}";
sepNavSelRange = "{24115, 0}";
sepNavVisRange = "{23577, 1037}";
};
};
EDDBF71412D2BD4400130D8A /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDFE39FA122BE7B700F24CD3 /* jensen_shannon.cpp */;
name = "jensen_shannon.cpp: 92";
rLen = 0;
rLoc = 2132;
rType = 0;
vrLen = 955;
vrLoc = 1806;
};
EDDBF71512D2BD4400130D8A /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDEBCDF8112DFD7600E2479E /* configure.ac */;
name = "configure.ac: 7";
rLen = 0;
rLoc = 213;
rType = 0;
vrLen = 857;
vrLoc = 0;
};
EDDC69911304DBC100637B75 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDD6A7A0115562EE00D3F668 /* Makefile.am */;
name = "Makefile.am: 133";
rLen = 0;
rLoc = 2798;
rType = 0;
vrLen = 1171;
vrLoc = 1957;
};
EDDC69AA1304DCE000637B75 /* cuffdiff.cpp:435 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152410C72963000A4F41 /* cuffdiff.cpp */;
functionName = "fdr_significance(double fdr, vector<SampleDifference*>& tests)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 435;
location = cuffdiff;
modificationTime = 319317165.207273;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDDC69BF1304DEF800637B75 /* cuffdiff.cpp:458 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152410C72963000A4F41 /* cuffdiff.cpp */;
functionName = "fdr_significance(double fdr, vector<SampleDifference*>& tests)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 458;
modificationTime = 319317165.207641;
originalNumberOfMultipleMatches = 1;
state = 0;
};
EDDC69C51304DF9000637B75 /* cuffdiff.cpp:452 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDA5152410C72963000A4F41 /* cuffdiff.cpp */;
functionName = "fdr_significance(double fdr, vector<SampleDifference*>& tests)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 452;
modificationTime = 319317165.207932;
originalNumberOfMultipleMatches = 1;
state = 0;
};
EDDC69D41304E09600637B75 /* differential.cpp:28 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDACE431114EFF5C009024DB /* differential.cpp */;
functionName = "test_diffexp(const FPKMContext& curr, const FPKMContext& prev, SampleDifference& test)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 28;
location = cuffdiff;
modificationTime = 319317165.208195;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDDC69EC1304E2C600637B75 /* differential.cpp:35 */ = {
isa = PBXFileBreakpoint;
actions = (
);
breakpointStyle = 0;
continueAfterActions = 0;
countType = 0;
delayBeforeContinue = 0;
fileReference = EDACE431114EFF5C009024DB /* differential.cpp */;
functionName = "test_diffexp(const FPKMContext& curr, const FPKMContext& prev, SampleDifference& test)";
hitCount = 0;
ignoreCount = 0;
lineNumber = 35;
location = cuffdiff;
modificationTime = 319317165.208446;
originalNumberOfMultipleMatches = 1;
state = 2;
};
EDDC69F01304E2FC00637B75 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5152410C72963000A4F41 /* cuffdiff.cpp */;
name = "cuffdiff.cpp: 452";
rLen = 19;
rLoc = 13672;
rType = 0;
vrLen = 870;
vrLoc = 13185;
};
EDE78A2B11B5F4F0000F8846 /* graph_optimize.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {976, 1235}}";
sepNavSelRange = "{2174, 30}";
sepNavVisRange = "{1179, 1378}";
};
};
EDE78A2C11B5F4F0000F8846 /* graph_optimize.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1373, 9555}}";
sepNavSelRange = "{18780, 0}";
sepNavVisRange = "{2854, 910}";
sepNavWindowFrame = "{{58, 0}, {1222, 778}}";
};
};
EDE78A7811B6E912000F8846 /* scaffold_graph.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {996, 697}}";
sepNavSelRange = "{372, 0}";
sepNavVisRange = "{0, 1012}";
};
};
EDE78A7911B6E912000F8846 /* scaffold_graph.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {1132, 4095}}";
sepNavSelRange = "{3213, 5}";
sepNavVisRange = "{2490, 1557}";
};
};
EDE78BC411B716C3000F8846 /* matching_merge.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {662, 1352}}";
sepNavSelRange = "{0, 0}";
sepNavVisRange = "{0, 773}";
};
};
EDE78BC511B716C3000F8846 /* matching_merge.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {654, 1482}}";
sepNavSelRange = "{2680, 14}";
sepNavVisRange = "{1739, 1080}";
};
};
EDEBCDF8112DFD7600E2479E /* configure.ac */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {728, 1937}}";
sepNavSelRange = "{213, 0}";
sepNavVisRange = "{0, 857}";
};
};
EDFDE77312BEA9100044EDD0 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDACE430114EFF5C009024DB /* differential.h */;
name = "differential.h: 130";
rLen = 8;
rLoc = 2989;
rType = 0;
vrLen = 1063;
vrLoc = 2462;
};
EDFDE78F12BEACA20044EDD0 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5152010C72963000A4F41 /* bundles.cpp */;
name = "bundles.cpp: 189";
rLen = 0;
rLoc = 4607;
rType = 0;
vrLen = 872;
vrLoc = 5236;
};
EDFE38AC12298E3400F24CD3 /* sp_counted_base_gcc_x86.hpp */ = {
isa = PBXFileReference;
lastKnownFileType = sourcecode.cpp.h;
name = sp_counted_base_gcc_x86.hpp;
path = "/usr/local/include/boost-1_41/boost/smart_ptr/detail/sp_counted_base_gcc_x86.hpp";
sourceTree = "<absolute>";
};
EDFE393512299AE500F24CD3 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5151B10C72963000A4F41 /* transitive_closure.h */;
name = "transitive_closure.h: 136";
rLen = 5;
rLoc = 4199;
rType = 0;
vrLen = 1910;
vrLoc = 3205;
};
EDFE39AF122BE4F400F24CD3 /* sorting_hat.cpp */ = {
isa = PBXFileReference;
fileEncoding = 4;
lastKnownFileType = sourcecode.cpp.cpp;
name = sorting_hat.cpp;
path = /Users/cole/develop/cufflinks/src/sorting_hat.cpp;
sourceTree = "<absolute>";
};
EDFE39B0122BE65600F24CD3 /* cuffcluster */ = {
activeExec = 0;
executables = (
EDFE39CF122BE65600F24CD3 /* cuffcluster */,
);
};
EDFE39CF122BE65600F24CD3 /* cuffcluster */ = {
isa = PBXExecutable;
activeArgIndices = (
NO,
YES,
YES,
YES,
YES,
YES,
NO,
NO,
);
argumentStrings = (
"--log-fpkm",
"--max-iterations 150",
"-k 3",
"--row-densities 2cond.densities",
2cond.fpkm_tracking,
2cond.sorting_hat_out,
xxx.fpkm_tracking,
xxx.sorting_hat_out,
);
autoAttachOnCrash = 1;
breakpointsEnabled = 1;
configStateDict = {
"PBXLSLaunchAction-0" = {
PBXLSLaunchAction = 0;
PBXLSLaunchStartAction = 1;
PBXLSLaunchStdioStyle = 2;
PBXLSLaunchStyle = 0;
class = PBXLSRunLaunchConfig;
commandLineArgs = (
);
displayName = "Executable Runner";
environment = {
};
identifier = com.apple.Xcode.launch.runConfig;
remoteHostInfo = "";
startActionInfo = "";
};
};
customDataFormattersEnabled = 1;
dataTipCustomDataFormattersEnabled = 1;
dataTipShowTypeColumn = 1;
dataTipSortType = 0;
debuggerPlugin = GDBDebugging;
disassemblyDisplayState = 0;
dylibVariantSuffix = "";
enableDebugStr = 1;
environmentEntries = (
);
executableSystemSymbolLevel = 0;
executableUserSymbolLevel = 0;
libgmallocEnabled = 0;
name = cuffcluster;
savedGlobals = {
};
showTypeColumn = 0;
sourceDirectories = (
);
startupPath = "/Users/cole/projects/Clone Wars/linc_db2_expression";
variableFormatDictionary = {
};
};
EDFE39FA122BE7B700F24CD3 /* jensen_shannon.cpp */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {728, 2288}}";
sepNavSelRange = "{2132, 0}";
sepNavVisRange = "{1806, 955}";
};
};
EDFE39FD122BE7CB00F24CD3 /* jensen_shannon.h */ = {
uiCtxt = {
sepNavIntBoundsRect = "{{0, 0}, {845, 606}}";
sepNavSelRange = "{383, 0}";
sepNavVisRange = "{0, 832}";
};
};
EDFE3A0C122BE93000F24CD3 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5152110C72963000A4F41 /* codons.cpp */;
name = "codons.cpp: 1";
rLen = 0;
rLoc = 0;
rType = 0;
vrLen = 3657;
vrLoc = 0;
};
EDFE3A0D122BE93000F24CD3 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDA5151A10C72963000A4F41 /* tokenize.h */;
name = "tokenize.h: 17";
rLen = 0;
rLoc = 380;
rType = 0;
vrLen = 417;
vrLoc = 0;
};
EDFE3A5B122C04D700F24CD3 /* PBXTextBookmark */ = {
isa = PBXTextBookmark;
fRef = EDFE39FD122BE7CB00F24CD3 /* jensen_shannon.h */;
name = "jensen_shannon.h: 18";
rLen = 0;
rLoc = 383;
rType = 0;
vrLen = 832;
vrLoc = 0;
};
}
================================================
FILE: cufflinks.xcodeproj/cole.perspectivev3
================================================
<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd">
<plist version="1.0">
<dict>
<key>ActivePerspectiveName</key>
<string>Project</string>
<key>AllowedModules</key>
<array>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>PBXSmartGroupTreeModule</string>
<key>Name</key>
<string>Groups and Files Outline View</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>PBXNavigatorGroup</string>
<key>Name</key>
<string>Editor</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>XCTaskListModule</string>
<key>Name</key>
<string>Task List</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>XCDetailModule</string>
<key>Name</key>
<string>File and Smart Group Detail Viewer</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>1</string>
<key>Module</key>
<string>PBXBuildResultsModule</string>
<key>Name</key>
<string>Detailed Build Results Viewer</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>1</string>
<key>Module</key>
<string>PBXProjectFindModule</string>
<key>Name</key>
<string>Project Batch Find Tool</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>XCProjectFormatConflictsModule</string>
<key>Name</key>
<string>Project Format Conflicts List</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>PBXBookmarksModule</string>
<key>Name</key>
<string>Bookmarks Tool</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>PBXClassBrowserModule</string>
<key>Name</key>
<string>Class Browser</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>PBXCVSModule</string>
<key>Name</key>
<string>Source Code Control Tool</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>PBXDebugBreakpointsModule</string>
<key>Name</key>
<string>Debug Breakpoints Tool</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>XCDockableInspector</string>
<key>Name</key>
<string>Inspector</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>PBXOpenQuicklyModule</string>
<key>Name</key>
<string>Open Quickly Tool</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>1</string>
<key>Module</key>
<string>PBXDebugSessionModule</string>
<key>Name</key>
<string>Debugger</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>1</string>
<key>Module</key>
<string>PBXDebugCLIModule</string>
<key>Name</key>
<string>Debug Console</string>
</dict>
<dict>
<key>BundleLoadPath</key>
<string></string>
<key>MaxInstances</key>
<string>n</string>
<key>Module</key>
<string>XCSnapshotModule</string>
<key>Name</key>
<string>Snapshots Tool</string>
</dict>
</array>
<key>BundlePath</key>
<string>/Developer/Library/PrivateFrameworks/DevToolsInterface.framework/Resources</string>
<key>Description</key>
<string>AIODescriptionKey</string>
<key>DockingSystemVisible</key>
<false/>
<key>Extension</key>
<string>perspectivev3</string>
<key>FavBarConfig</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>EDA514FF10C72929000A4F41</string>
<key>XCBarModuleItemNames</key>
<dict/>
<key>XCBarModuleItems</key>
<array/>
</dict>
<key>FirstTimeWindowDisplayed</key>
<false/>
<key>Identifier</key>
<string>com.apple.perspectives.project.defaultV3</string>
<key>MajorVersion</key>
<integer>34</integer>
<key>MinorVersion</key>
<integer>0</integer>
<key>Name</key>
<string>All-In-One</string>
<key>Notifications</key>
<array/>
<key>OpenEditors</key>
<array/>
<key>PerspectiveWidths</key>
<array>
<integer>1063</integer>
<integer>1063</integer>
</array>
<key>Perspectives</key>
<array>
<dict>
<key>ChosenToolbarItems</key>
<array>
<string>XCToolbarPerspectiveControl</string>
<string>NSToolbarSeparatorItem</string>
<string>active-combo-popup</string>
<string>action</string>
<string>active-architecture-popup</string>
<string>active-executable-popup</string>
<string>NSToolbarFlexibleSpaceItem</string>
<string>debugger-enable-breakpoints</string>
<string>build-and-go</string>
<string>com.apple.ide.PBXToolbarStopButton</string>
<string>get-info</string>
<string>NSToolbarFlexibleSpaceItem</string>
<string>com.apple.pbx.toolbar.searchfield</string>
</array>
<key>ControllerClassBaseName</key>
<string></string>
<key>IconName</key>
<string>WindowOfProject</string>
<key>Identifier</key>
<string>perspective.project</string>
<key>IsVertical</key>
<false/>
<key>Layout</key>
<array>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXBottomSmartGroupGIDs</key>
<array>
<string>1C37FBAC04509CD000000102</string>
<string>1C37FAAC04509CD000000102</string>
<string>1C37FABC05509CD000000102</string>
<string>1C37FABC05539CD112110102</string>
<string>E2644B35053B69B200211256</string>
<string>1C37FABC04509CD000100104</string>
<string>1CC0EA4004350EF90044410B</string>
<string>1CC0EA4004350EF90041110B</string>
<string>1C77FABC04509CD000000102</string>
</array>
<key>PBXProjectModuleGUID</key>
<string>1CA23ED40692098700951B8B</string>
<key>PBXProjectModuleLabel</key>
<string>Files</string>
<key>PBXProjectStructureProvided</key>
<string>yes</string>
<key>PBXSmartGroupTreeModuleColumnData</key>
<dict>
<key>PBXSmartGroupTreeModuleColumnWidthsKey</key>
<array>
<real>267</real>
</array>
<key>PBXSmartGroupTreeModuleColumnsKey_v4</key>
<array>
<string>MainColumn</string>
</array>
</dict>
<key>PBXSmartGroupTreeModuleOutlineStateKey_v7</key>
<dict>
<key>PBXSmartGroupTreeModuleOutlineStateExpansionKey</key>
<array>
<string>08FB7794FE84155DC02AAC07</string>
<string>0A25E74A1242E9270080BEA9</string>
<string>ED1C0C6D11D7D9C000CFD663</string>
<string>C6859E8C029090F304C91782</string>
<string>1C37FBAC04509CD000000102</string>
<string>1C37FAAC04509CD000000102</string>
<string>1C77FABC04509CD000000102</string>
<string>1C3E0DCA080725EA00A55177</string>
</array>
<key>PBXSmartGroupTreeModuleOutlineStateSelectionKey</key>
<array>
<array>
<integer>23</integer>
<integer>5</integer>
<integer>0</integer>
</array>
</array>
<key>PBXSmartGroupTreeModuleOutlineStateVisibleRectKey</key>
<string>{{0, 300}, {267, 914}}</string>
</dict>
<key>PBXTopSmartGroupGIDs</key>
<array/>
<key>XCIncludePerspectivesSwitch</key>
<false/>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{0, 0}, {284, 932}}</string>
<key>GroupTreeTableConfiguration</key>
<array>
<string>MainColumn</string>
<real>267</real>
</array>
<key>RubberWindowFrame</key>
<string>469 55 1063 973 0 0 1680 1028 </string>
</dict>
<key>Module</key>
<string>PBXSmartGroupTreeModule</string>
<key>Proportion</key>
<string>284pt</string>
</dict>
<dict>
<key>Dock</key>
<array>
<dict>
<key>BecomeActive</key>
<true/>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>EDA514FA10C72929000A4F41</string>
<key>PBXProjectModuleLabel</key>
<string>cufflinks.cpp</string>
<key>PBXSplitModuleInNavigatorKey</key>
<dict>
<key>Split0</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>EDA514FB10C72929000A4F41</string>
<key>PBXProjectModuleLabel</key>
<string>cufflinks.cpp</string>
<key>_historyCapacity</key>
<integer>0</integer>
<key>bookmark</key>
<string>EDC584C913087F870013090E</string>
<key>history</key>
<array>
<string>EDBBA10211DA433F0015175B</string>
<string>EDBBA3FA11DD8E140015175B</string>
<string>ED70726B11F79D170028F305</string>
<string>EDFE393512299AE500F24CD3</string>
<string>EDFE3A0C122BE93000F24CD3</string>
<string>EDFE3A0D122BE93000F24CD3</string>
<string>EDFE3A5B122C04D700F24CD3</string>
<string>ED291363122D32B500C3703E</string>
<string>EDBCDD4B1235E4090050A8E4</string>
<string>EDBCDD4D1235E4090050A8E4</string>
<string>EDBCDDFB1235EEB60050A8E4</string>
<string>EDBCDDFC1235EEB60050A8E4</string>
<string>EDBCDF80123721790050A8E4</string>
<string>ED48339D12400ED100642337</string>
<string>ED48351812415CA300642337</string>
<string>ED4835AE12481D1900642337</string>
<string>ED7CFAE71294286100DB052B</string>
<string>ED7CFAEA1294286100DB052B</string>
<string>EDAE42851298369000F35B48</string>
<string>ED79DB8512A49C3400ABC8B3</string>
<string>ED79DC1E12AC5D4E00ABC8B3</string>
<string>ED79DC9912AC5F1A00ABC8B3</string>
<string>ED79DC9B12AC5F1A00ABC8B3</string>
<string>ED79DCB212AC629D00ABC8B3</string>
<string>EDFDE77312BEA9100044EDD0</string>
<string>EDFDE78F12BEACA20044EDD0</string>
<string>ED0E3EF212CB949000074D2E</string>
<string>ED0E3F0712CB97B000074D2E</string>
<string>EDDBF71412D2BD4400130D8A</string>
<string>EDDBF71512D2BD4400130D8A</string>
<string>EDA5B99312F6599F005AEC09</string>
<string>ED78C54112F52C6E00111993</string>
<string>EDC57A9512F7CC9F00493081</string>
<string>EDC57AE012F7D66C00493081</string>
<string>EDC57AF312F8580200493081</string>
<string>EDC57AF612F8580200493081</string>
<string>EDC57B0C12F859B500493081</string>
<string>EDC57B1212F85B6E00493081</string>
<string>EDDC69911304DBC100637B75</string>
<string>EDDC69F01304E2FC00637B75</string>
<string>EDC58391130833E90013090E</string>
<string>EDC58392130833E90013090E</string>
<string>EDC58393130833E90013090E</string>
<string>EDC58394130833E90013090E</string>
<string>EDC583B6130845640013090E</string>
<string>EDC583B7130845640013090E</string>
<string>EDC583F0130855740013090E</string>
<string>EDC584BD130865E80013090E</string>
<string>EDC584C5130866820013090E</string>
<string>EDC584C6130866820013090E</string>
<string>EDC584C7130866820013090E</string>
</array>
</dict>
<key>SplitCount</key>
<string>1</string>
</dict>
<key>StatusBarVisibility</key>
<true/>
<key>XCSharingToken</key>
<string>com.apple.Xcode.CommonNavigatorGroupSharingToken</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{0, 0}, {774, 691}}</string>
<key>RubberWindowFrame</key>
<string>469 55 1063 973 0 0 1680 1028 </string>
</dict>
<key>Module</key>
<string>PBXNavigatorGroup</string>
<key>Proportion</key>
<string>691pt</string>
</dict>
<dict>
<key>Proportion</key>
<string>236pt</string>
<key>Tabs</key>
<array>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CA23EDF0692099D00951B8B</string>
<key>PBXProjectModuleLabel</key>
<string>Detail</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{10, 27}, {723, 209}}</string>
</dict>
<key>Module</key>
<string>XCDetailModule</string>
</dict>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CA23EE00692099D00951B8B</string>
<key>PBXProjectModuleLabel</key>
<string>Project Find</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{10, 27}, {774, 209}}</string>
</dict>
<key>Module</key>
<string>PBXProjectFindModule</string>
</dict>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXCVSModuleFilterTypeKey</key>
<integer>1032</integer>
<key>PBXProjectModuleGUID</key>
<string>1CA23EE10692099D00951B8B</string>
<key>PBXProjectModuleLabel</key>
<string>SCM Results</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{10, 27}, {1002, 287}}</string>
</dict>
<key>Module</key>
<string>PBXCVSModule</string>
</dict>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>XCMainBuildResultsModuleGUID</string>
<key>PBXProjectModuleLabel</key>
<string>Build Results</string>
<key>XCBuildResultsTrigger_Collapse</key>
<integer>1021</integer>
<key>XCBuildResultsTrigger_Open</key>
<integer>1011</integer>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{10, 27}, {774, 209}}</string>
<key>RubberWindowFrame</key>
<string>469 55 1063 973 0 0 1680 1028 </string>
</dict>
<key>Module</key>
<string>PBXBuildResultsModule</string>
</dict>
</array>
</dict>
</array>
<key>Proportion</key>
<string>774pt</string>
</dict>
</array>
<key>Name</key>
<string>Project</string>
<key>ServiceClasses</key>
<array>
<string>XCModuleDock</string>
<string>PBXSmartGroupTreeModule</string>
<string>XCModuleDock</string>
<string>PBXNavigatorGroup</string>
<string>XCDockableTabModule</string>
<string>XCDetailModule</string>
<string>PBXProjectFindModule</string>
<string>PBXCVSModule</string>
<string>PBXBuildResultsModule</string>
</array>
<key>TableOfContents</key>
<array>
<string>EDC583AB1308445A0013090E</string>
<string>1CA23ED40692098700951B8B</string>
<string>EDC583AC1308445A0013090E</string>
<string>EDA514FA10C72929000A4F41</string>
<string>EDC583AD1308445A0013090E</string>
<string>1CA23EDF0692099D00951B8B</string>
<string>1CA23EE00692099D00951B8B</string>
<string>1CA23EE10692099D00951B8B</string>
<string>XCMainBuildResultsModuleGUID</string>
</array>
<key>ToolbarConfigUserDefaultsMinorVersion</key>
<string>2</string>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.defaultV3</string>
</dict>
<dict>
<key>ChosenToolbarItems</key>
<array>
<string>XCToolbarPerspectiveControl</string>
<string>NSToolbarSeparatorItem</string>
<string>active-combo-popup</string>
<string>NSToolbarFlexibleSpaceItem</string>
<string>debugger-enable-breakpoints</string>
<string>build-and-go</string>
<string>com.apple.ide.PBXToolbarStopButton</string>
<string>debugger-restart-executable</string>
<string>debugger-pause</string>
<string>debugger-step-over</string>
<string>debugger-step-into</string>
<string>debugger-step-out</string>
<string>NSToolbarFlexibleSpaceItem</string>
<string>servicesModulebreakpoints</string>
<string>debugger-show-console-window</string>
</array>
<key>ControllerClassBaseName</key>
<string>PBXDebugSessionModule</string>
<key>IconName</key>
<string>DebugTabIcon</string>
<key>Identifier</key>
<string>perspective.debug</string>
<key>IsVertical</key>
<true/>
<key>Layout</key>
<array>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CCC7628064C1048000F2A68</string>
<key>PBXProjectModuleLabel</key>
<string>Debugger Console</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{0, 0}, {1063, 267}}</string>
</dict>
<key>Module</key>
<string>PBXDebugCLIModule</string>
<key>Proportion</key>
<string>267pt</string>
</dict>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>Debugger</key>
<dict>
<key>HorizontalSplitView</key>
<dict>
<key>_collapsingFrameDimension</key>
<real>0.0</real>
<key>_indexOfCollapsedView</key>
<integer>0</integer>
<key>_percentageOfCollapsedView</key>
<real>0.0</real>
<key>isCollapsed</key>
<string>yes</string>
<key>sizes</key>
<array>
<string>{{0, 0}, {498, 411}}</string>
<string>{{498, 0}, {565, 411}}</string>
</array>
</dict>
<key>VerticalSplitView</key>
<dict>
<key>_collapsingFrameDimension</key>
<real>0.0</real>
<key>_indexOfCollapsedView</key>
<integer>0</integer>
<key>_percentageOfCollapsedView</key>
<real>0.0</real>
<key>isCollapsed</key>
<string>yes</string>
<key>sizes</key>
<array>
<string>{{0, 0}, {1063, 411}}</string>
<string>{{0, 411}, {1063, 310}}</string>
</array>
</dict>
</dict>
<key>LauncherConfigVersion</key>
<string>8</string>
<key>PBXProjectModuleGUID</key>
<string>1CCC7629064C1048000F2A68</string>
<key>PBXProjectModuleLabel</key>
<string>Debug</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>DebugConsoleVisible</key>
<string>None</string>
<key>DebugConsoleWindowFrame</key>
<string>{{200, 200}, {500, 300}}</string>
<key>DebugSTDIOWindowFrame</key>
<string>{{200, 200}, {500, 300}}</string>
<key>Frame</key>
<string>{{0, 272}, {1063, 721}}</string>
<key>PBXDebugSessionStackFrameViewKey</key>
<dict>
<key>DebugVariablesTableConfiguration</key>
<array>
<string>Name</string>
<real>235</real>
<string>Value</string>
<real>85</real>
<string>Summary</string>
<real>220</real>
</array>
<key>Frame</key>
<string>{{498, 0}, {565, 411}}</string>
</dict>
</dict>
<key>Module</key>
<string>PBXDebugSessionModule</string>
<key>Proportion</key>
<string>721pt</string>
</dict>
</array>
<key>Name</key>
<string>Debug</string>
<key>ServiceClasses</key>
<array>
<string>XCModuleDock</string>
<string>PBXDebugCLIModule</string>
<string>PBXDebugSessionModule</string>
<string>PBXDebugProcessAndThreadModule</string>
<string>PBXDebugProcessViewModule</string>
<string>PBXDebugThreadViewModule</string>
<string>PBXDebugStackFrameViewModule</string>
<string>PBXNavigatorGroup</string>
</array>
<key>TableOfContents</key>
<array>
<string>EDC583F7130855A90013090E</string>
<string>1CCC7628064C1048000F2A68</string>
<string>1CCC7629064C1048000F2A68</string>
<string>EDC583F8130855A90013090E</string>
<string>EDC583F9130855A90013090E</string>
<string>EDC583FA130855A90013090E</string>
<string>EDC583FB130855A90013090E</string>
<string>EDA514FA10C72929000A4F41</string>
</array>
<key>ToolbarConfigUserDefaultsMinorVersion</key>
<string>2</string>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.debugV3</string>
</dict>
</array>
<key>PerspectivesBarVisible</key>
<true/>
<key>ShelfIsVisible</key>
<false/>
<key>SourceDescription</key>
<string>file at '/Developer/Library/PrivateFrameworks/DevToolsInterface.framework/Resources/XCPerspectivesSpecification.xcperspec'</string>
<key>StatusbarIsVisible</key>
<true/>
<key>TimeStamp</key>
<real>0.0</real>
<key>ToolbarConfigUserDefaultsMinorVersion</key>
<string>2</string>
<key>ToolbarDisplayMode</key>
<integer>1</integer>
<key>ToolbarIsVisible</key>
<true/>
<key>ToolbarSizeMode</key>
<integer>1</integer>
<key>Type</key>
<string>Perspectives</string>
<key>UpdateMessage</key>
<string></string>
<key>WindowJustification</key>
<integer>5</integer>
<key>WindowOrderList</key>
<array>
<string>EDC583FD130855A90013090E</string>
<string>EDC583FE130855A90013090E</string>
<string>/Users/cole/develop/cufflinks/cufflinks.xcodeproj</string>
</array>
<key>WindowString</key>
<string>469 55 1063 973 0 0 1680 1028 </string>
<key>WindowToolsV3</key>
<array>
<dict>
<key>Identifier</key>
<string>windowTool.debugger</string>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>Debugger</key>
<dict>
<key>HorizontalSplitView</key>
<dict>
<key>_collapsingFrameDimension</key>
<real>0.0</real>
<key>_indexOfCollapsedView</key>
<integer>0</integer>
<key>_percentageOfCollapsedView</key>
<real>0.0</real>
<key>isCollapsed</key>
<string>yes</string>
<key>sizes</key>
<array>
<string>{{0, 0}, {317, 164}}</string>
<string>{{317, 0}, {377, 164}}</string>
</array>
</dict>
<key>VerticalSplitView</key>
<dict>
<key>_collapsingFrameDimension</key>
<real>0.0</real>
<key>_indexOfCollapsedView</key>
<integer>0</integer>
<key>_percentageOfCollapsedView</key>
<real>0.0</real>
<key>isCollapsed</key>
<string>yes</string>
<key>sizes</key>
<array>
<string>{{0, 0}, {694, 164}}</string>
<string>{{0, 164}, {694, 216}}</string>
</array>
</dict>
</dict>
<key>LauncherConfigVersion</key>
<string>8</string>
<key>PBXProjectModuleGUID</key>
<string>1C162984064C10D400B95A72</string>
<key>PBXProjectModuleLabel</key>
<string>Debug - GLUTExamples (Underwater)</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>DebugConsoleDrawerSize</key>
<string>{100, 120}</string>
<key>DebugConsoleVisible</key>
<string>None</string>
<key>DebugConsoleWindowFrame</key>
<string>{{200, 200}, {500, 300}}</string>
<key>DebugSTDIOWindowFrame</key>
<string>{{200, 200}, {500, 300}}</string>
<key>Frame</key>
<string>{{0, 0}, {694, 380}}</string>
<key>RubberWindowFrame</key>
<string>321 238 694 422 0 0 1440 878 </string>
</dict>
<key>Module</key>
<string>PBXDebugSessionModule</string>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Name</key>
<string>Debugger</string>
<key>ServiceClasses</key>
<array>
<string>PBXDebugSessionModule</string>
</array>
<key>StatusbarIsVisible</key>
<integer>1</integer>
<key>TableOfContents</key>
<array>
<string>1CD10A99069EF8BA00B06720</string>
<string>1C0AD2AB069F1E9B00FABCE6</string>
<string>1C162984064C10D400B95A72</string>
<string>1C0AD2AC069F1E9B00FABCE6</string>
</array>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.debugV3</string>
<key>WindowString</key>
<string>321 238 694 422 0 0 1440 878 </string>
<key>WindowToolGUID</key>
<string>1CD10A99069EF8BA00B06720</string>
<key>WindowToolIsVisible</key>
<integer>0</integer>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.build</string>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CD0528F0623707200166675</string>
<key>PBXProjectModuleLabel</key>
<string><No Editor></string>
<key>PBXSplitModuleInNavigatorKey</key>
<dict>
<key>Split0</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CD052900623707200166675</string>
</dict>
<key>SplitCount</key>
<string>1</string>
</dict>
<key>StatusBarVisibility</key>
<integer>1</integer>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{0, 0}, {500, 215}}</string>
<key>RubberWindowFrame</key>
<string>192 257 500 500 0 0 1280 1002 </string>
</dict>
<key>Module</key>
<string>PBXNavigatorGroup</string>
<key>Proportion</key>
<string>218pt</string>
</dict>
<dict>
<key>BecomeActive</key>
<integer>1</integer>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>XCMainBuildResultsModuleGUID</string>
<key>PBXProjectModuleLabel</key>
<string>Build Results</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{0, 222}, {500, 236}}</string>
<key>RubberWindowFrame</key>
<string>192 257 500 500 0 0 1280 1002 </string>
</dict>
<key>Module</key>
<string>PBXBuildResultsModule</string>
<key>Proportion</key>
<string>236pt</string>
</dict>
</array>
<key>Proportion</key>
<string>458pt</string>
</dict>
</array>
<key>Name</key>
<string>Build Results</string>
<key>ServiceClasses</key>
<array>
<string>PBXBuildResultsModule</string>
</array>
<key>StatusbarIsVisible</key>
<integer>1</integer>
<key>TableOfContents</key>
<array>
<string>1C78EAA5065D492600B07095</string>
<string>1C78EAA6065D492600B07095</string>
<string>1CD0528F0623707200166675</string>
<string>XCMainBuildResultsModuleGUID</string>
</array>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.buildV3</string>
<key>WindowString</key>
<string>192 257 500 500 0 0 1280 1002 </string>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.find</string>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CDD528C0622207200134675</string>
<key>PBXProjectModuleLabel</key>
<string><No Editor></string>
<key>PBXSplitModuleInNavigatorKey</key>
<dict>
<key>Split0</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CD0528D0623707200166675</string>
</dict>
<key>SplitCount</key>
<string>1</string>
</dict>
<key>StatusBarVisibility</key>
<integer>1</integer>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{0, 0}, {781, 167}}</string>
<key>RubberWindowFrame</key>
<string>62 385 781 470 0 0 1440 878 </string>
</dict>
<key>Module</key>
<string>PBXNavigatorGroup</string>
<key>Proportion</key>
<string>781pt</string>
</dict>
</array>
<key>Proportion</key>
<string>50%</string>
</dict>
<dict>
<key>BecomeActive</key>
<integer>1</integer>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CD0528E0623707200166675</string>
<key>PBXProjectModuleLabel</key>
<string>Project Find</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{8, 0}, {773, 254}}</string>
<key>RubberWindowFrame</key>
<string>62 385 781 470 0 0 1440 878 </string>
</dict>
<key>Module</key>
<string>PBXProjectFindModule</string>
<key>Proportion</key>
<string>50%</string>
</dict>
</array>
<key>Proportion</key>
<string>428pt</string>
</dict>
</array>
<key>Name</key>
<string>Project Find</string>
<key>ServiceClasses</key>
<array>
<string>PBXProjectFindModule</string>
</array>
<key>StatusbarIsVisible</key>
<integer>1</integer>
<key>TableOfContents</key>
<array>
<string>1C530D57069F1CE1000CFCEE</string>
<string>1C530D58069F1CE1000CFCEE</string>
<string>1C530D59069F1CE1000CFCEE</string>
<string>1CDD528C0622207200134675</string>
<string>1C530D5A069F1CE1000CFCEE</string>
<string>1CE0B1FE06471DED0097A5F4</string>
<string>1CD0528E0623707200166675</string>
</array>
<key>WindowString</key>
<string>62 385 781 470 0 0 1440 878 </string>
<key>WindowToolGUID</key>
<string>1C530D57069F1CE1000CFCEE</string>
<key>WindowToolIsVisible</key>
<integer>0</integer>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.snapshots</string>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>Module</key>
<string>XCSnapshotModule</string>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Name</key>
<string>Snapshots</string>
<key>ServiceClasses</key>
<array>
<string>XCSnapshotModule</string>
</array>
<key>StatusbarIsVisible</key>
<string>Yes</string>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.snapshots</string>
<key>WindowString</key>
<string>315 824 300 550 0 0 1440 878 </string>
<key>WindowToolIsVisible</key>
<string>Yes</string>
</dict>
<dict>
<key>FirstTimeWindowDisplayed</key>
<false/>
<key>Identifier</key>
<string>windowTool.debuggerConsole</string>
<key>IsVertical</key>
<true/>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1C78EAAC065D492600B07095</string>
<key>PBXProjectModuleLabel</key>
<string>Debugger Console</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{0, 0}, {440, 359}}</string>
<key>RubberWindowFrame</key>
<string>267 368 440 400 0 0 1280 778 </string>
</dict>
<key>Module</key>
<string>PBXDebugCLIModule</string>
<key>Proportion</key>
<string>359pt</string>
</dict>
</array>
<key>Proportion</key>
<string>359pt</string>
</dict>
</array>
<key>Name</key>
<string>Debugger Console</string>
<key>ServiceClasses</key>
<array>
<string>PBXDebugCLIModule</string>
</array>
<key>StatusbarIsVisible</key>
<true/>
<key>TableOfContents</key>
<array>
<string>1C530D5B069F1CE1000CFCEE</string>
<string>EDA1843F119F1BE300E815BB</string>
<string>1C78EAAC065D492600B07095</string>
</array>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.consoleV3</string>
<key>WindowString</key>
<string>267 368 440 400 0 0 1280 778 </string>
<key>WindowToolGUID</key>
<string>1C530D5B069F1CE1000CFCEE</string>
<key>WindowToolIsVisible</key>
<false/>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.scm</string>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1C78EAB2065D492600B07095</string>
<key>PBXProjectModuleLabel</key>
<string><No Editor></string>
<key>PBXSplitModuleInNavigatorKey</key>
<dict>
<key>Split0</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1C78EAB3065D492600B07095</string>
</dict>
<key>SplitCount</key>
<string>1</string>
</dict>
<key>StatusBarVisibility</key>
<integer>1</integer>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{0, 0}, {452, 0}}</string>
<key>RubberWindowFrame</key>
<string>743 379 452 308 0 0 1280 1002 </string>
</dict>
<key>Module</key>
<string>PBXNavigatorGroup</string>
<key>Proportion</key>
<string>0pt</string>
</dict>
<dict>
<key>BecomeActive</key>
<integer>1</integer>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CD052920623707200166675</string>
<key>PBXProjectModuleLabel</key>
<string>SCM</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>ConsoleFrame</key>
<string>{{0, 259}, {452, 0}}</string>
<key>Frame</key>
<string>{{0, 7}, {452, 259}}</string>
<key>RubberWindowFrame</key>
<string>743 379 452 308 0 0 1280 1002 </string>
<key>TableConfiguration</key>
<array>
<string>Status</string>
<real>30</real>
<string>FileName</string>
<real>199</real>
<string>Path</string>
<real>197.09500122070312</real>
</array>
<key>TableFrame</key>
<string>{{0, 0}, {452, 250}}</string>
</dict>
<key>Module</key>
<string>PBXCVSModule</string>
<key>Proportion</key>
<string>262pt</string>
</dict>
</array>
<key>Proportion</key>
<string>266pt</string>
</dict>
</array>
<key>Name</key>
<string>SCM</string>
<key>ServiceClasses</key>
<array>
<string>PBXCVSModule</string>
</array>
<key>StatusbarIsVisible</key>
<integer>1</integer>
<key>TableOfContents</key>
<array>
<string>1C78EAB4065D492600B07095</string>
<string>1C78EAB5065D492600B07095</string>
<string>1C78EAB2065D492600B07095</string>
<string>1CD052920623707200166675</string>
</array>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.scmV3</string>
<key>WindowString</key>
<string>743 379 452 308 0 0 1280 1002 </string>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.breakpoints</string>
<key>IsVertical</key>
<integer>0</integer>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>BecomeActive</key>
<integer>1</integer>
<key>ContentConfiguration</key>
<dict>
<key>PBXBottomSmartGroupGIDs</key>
<array>
<string>1C77FABC04509CD000000102</string>
</array>
<key>PBXProjectModuleGUID</key>
<string>1CE0B1FE06471DED0097A5F4</string>
<key>PBXProjectModuleLabel</key>
<string>Files</string>
<key>PBXProjectStructureProvided</key>
<string>no</string>
<key>PBXSmartGroupTreeModuleColumnData</key>
<dict>
<key>PBXSmartGroupTreeModuleColumnWidthsKey</key>
<array>
<real>168</real>
</array>
<key>PBXSmartGroupTreeModuleColumnsKey_v4</key>
<array>
<string>MainColumn</string>
</array>
</dict>
<key>PBXSmartGroupTreeModuleOutlineStateKey_v7</key>
<dict>
<key>PBXSmartGroupTreeModuleOutlineStateExpansionKey</key>
<array>
<string>1C77FABC04509CD000000102</string>
</array>
<key>PBXSmartGroupTreeModuleOutlineStateSelectionKey</key>
<array>
<array>
<integer>0</integer>
</array>
</array>
<key>PBXSmartGroupTreeModuleOutlineStateVisibleRectKey</key>
<string>{{0, 0}, {168, 350}}</string>
</dict>
<key>PBXTopSmartGroupGIDs</key>
<array/>
<key>XCIncludePerspectivesSwitch</key>
<integer>0</integer>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{0, 0}, {185, 368}}</string>
<key>GroupTreeTableConfiguration</key>
<array>
<string>MainColumn</string>
<real>168</real>
</array>
<key>RubberWindowFrame</key>
<string>315 424 744 409 0 0 1440 878 </string>
</dict>
<key>Module</key>
<string>PBXSmartGroupTreeModule</string>
<key>Proportion</key>
<string>185pt</string>
</dict>
<dict>
<key>ContentConfiguration</key>
<dict>
<key>PBXProjectModuleGUID</key>
<string>1CA1AED706398EBD00589147</string>
<key>PBXProjectModuleLabel</key>
<string>Detail</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{{190, 0}, {554, 368}}</string>
<key>RubberWindowFrame</key>
<string>315 424 744 409 0 0 1440 878 </string>
</dict>
<key>Module</key>
<string>XCDetailModule</string>
<key>Proportion</key>
<string>554pt</string>
</dict>
</array>
<key>Proportion</key>
<string>368pt</string>
</dict>
</array>
<key>MajorVersion</key>
<integer>3</integer>
<key>MinorVersion</key>
<integer>0</integer>
<key>Name</key>
<string>Breakpoints</string>
<key>ServiceClasses</key>
<array>
<string>PBXSmartGroupTreeModule</string>
<string>XCDetailModule</string>
</array>
<key>StatusbarIsVisible</key>
<integer>1</integer>
<key>TableOfContents</key>
<array>
<string>1CDDB66807F98D9800BB5817</string>
<string>1CDDB66907F98D9800BB5817</string>
<string>1CE0B1FE06471DED0097A5F4</string>
<string>1CA1AED706398EBD00589147</string>
</array>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.breakpointsV3</string>
<key>WindowString</key>
<string>315 424 744 409 0 0 1440 878 </string>
<key>WindowToolGUID</key>
<string>1CDDB66807F98D9800BB5817</string>
<key>WindowToolIsVisible</key>
<integer>1</integer>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.debugAnimator</string>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>Module</key>
<string>PBXNavigatorGroup</string>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Name</key>
<string>Debug Visualizer</string>
<key>ServiceClasses</key>
<array>
<string>PBXNavigatorGroup</string>
</array>
<key>StatusbarIsVisible</key>
<integer>1</integer>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.debugAnimatorV3</string>
<key>WindowString</key>
<string>100 100 700 500 0 0 1280 1002 </string>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.bookmarks</string>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>Module</key>
<string>PBXBookmarksModule</string>
<key>Proportion</key>
<string>166pt</string>
</dict>
</array>
<key>Proportion</key>
<string>166pt</string>
</dict>
</array>
<key>Name</key>
<string>Bookmarks</string>
<key>ServiceClasses</key>
<array>
<string>PBXBookmarksModule</string>
</array>
<key>StatusbarIsVisible</key>
<integer>0</integer>
<key>WindowString</key>
<string>538 42 401 187 0 0 1280 1002 </string>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.projectFormatConflicts</string>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>Module</key>
<string>XCProjectFormatConflictsModule</string>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Name</key>
<string>Project Format Conflicts</string>
<key>ServiceClasses</key>
<array>
<string>XCProjectFormatConflictsModule</string>
</array>
<key>StatusbarIsVisible</key>
<integer>0</integer>
<key>WindowContentMinSize</key>
<string>450 300</string>
<key>WindowString</key>
<string>50 850 472 307 0 0 1440 877</string>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.classBrowser</string>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>BecomeActive</key>
<integer>1</integer>
<key>ContentConfiguration</key>
<dict>
<key>OptionsSetName</key>
<string>Hierarchy, all classes</string>
<key>PBXProjectModuleGUID</key>
<string>1CA6456E063B45B4001379D8</string>
<key>PBXProjectModuleLabel</key>
<string>Class Browser - NSObject</string>
</dict>
<key>GeometryConfiguration</key>
<dict>
<key>ClassesFrame</key>
<string>{{0, 0}, {369, 96}}</string>
<key>ClassesTreeTableConfiguration</key>
<array>
<string>PBXClassNameColumnIdentifier</string>
<real>208</real>
<string>PBXClassBookColumnIdentifier</string>
<real>22</real>
</array>
<key>Frame</key>
<string>{{0, 0}, {616, 353}}</string>
<key>MembersFrame</key>
<string>{{0, 105}, {369, 395}}</string>
<key>MembersTreeTableConfiguration</key>
<array>
<string>PBXMemberTypeIconColumnIdentifier</string>
<real>22</real>
<string>PBXMemberNameColumnIdentifier</string>
<real>216</real>
<string>PBXMemberTypeColumnIdentifier</string>
<real>94</real>
<string>PBXMemberBookColumnIdentifier</string>
<real>22</real>
</array>
<key>PBXModuleWindowStatusBarHidden2</key>
<integer>1</integer>
<key>RubberWindowFrame</key>
<string>597 125 616 374 0 0 1280 1002 </string>
</dict>
<key>Module</key>
<string>PBXClassBrowserModule</string>
<key>Proportion</key>
<string>354pt</string>
</dict>
</array>
<key>Proportion</key>
<string>354pt</string>
</dict>
</array>
<key>Name</key>
<string>Class Browser</string>
<key>ServiceClasses</key>
<array>
<string>PBXClassBrowserModule</string>
</array>
<key>StatusbarIsVisible</key>
<integer>0</integer>
<key>TableOfContents</key>
<array>
<string>1C78EABA065D492600B07095</string>
<string>1C78EABB065D492600B07095</string>
<string>1CA6456E063B45B4001379D8</string>
</array>
<key>ToolbarConfiguration</key>
<string>xcode.toolbar.config.classbrowser</string>
<key>WindowString</key>
<string>597 125 616 374 0 0 1280 1002 </string>
</dict>
<dict>
<key>Identifier</key>
<string>windowTool.refactoring</string>
<key>IncludeInToolsMenu</key>
<integer>0</integer>
<key>Layout</key>
<array>
<dict>
<key>Dock</key>
<array>
<dict>
<key>BecomeActive</key>
<integer>1</integer>
<key>GeometryConfiguration</key>
<dict>
<key>Frame</key>
<string>{0, 0}, {500, 335}</string>
<key>RubberWindowFrame</key>
<string>{0, 0}, {500, 335}</string>
</dict>
<key>Module</key>
<string>XCRefactoringModule</string>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Proportion</key>
<string>100%</string>
</dict>
</array>
<key>Name</key>
<string>Refactoring</string>
<key>ServiceClasses</key>
<array>
<string>XCRefactoringModule</string>
</array>
<key>WindowString</key>
<string>200 200 500 356 0 0 1920 1200 </string>
</dict>
</array>
</dict>
</plist>
================================================
FILE: cufflinks.xcodeproj/project.pbxproj
================================================
// !$*UTF8*$!
{
archiveVersion = 1;
classes = {
};
objectVersion = 46;
objects = {
/* Begin PBXBuildFile section */
0A6183721324308800EFF9AF /* multireads.cpp in Sources */ = {isa = PBXBuildFile; fileRef = 0A6183711324308800EFF9AF /* multireads.cpp */; };
0A6183731324308800EFF9AF /* multireads.cpp in Sources */ = {isa = PBXBuildFile; fileRef = 0A6183711324308800EFF9AF /* multireads.cpp */; };
0A69414F132AEDAB00558D76 /* dens_haz.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F3613213B19008DDA0B /* dens_haz.c */; };
0A694150132AEDAB00558D76 /* dens_int.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F3713213B19008DDA0B /* dens_int.c */; };
0A694151132AEDAB00558D76 /* dens_odi.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F3813213B19008DDA0B /* dens_odi.c */; };
0A694152132AEDAB00558D76 /* vari.cpp in Sources */ = {isa = PBXBuildFile; fileRef = ED920F3313213903008DDA0B /* vari.cpp */; };
0A694153132AEDAB00558D76 /* density.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F30132137F4008DDA0B /* density.c */; };
0A694154132AEDAB00558D76 /* minmax.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5D13204FE30031949A /* minmax.c */; };
0A694155132AEDAB00558D76 /* locfit.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5E13204FE30031949A /* locfit.c */; };
0A694156132AEDAB00558D76 /* ev_interp.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5F13204FE30031949A /* ev_interp.c */; };
0A694157132AEDAB00558D76 /* ev_atree.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6013204FE30031949A /* ev_atree.c */; };
0A694158132AEDAB00558D76 /* weight.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6113204FE30031949A /* weight.c */; };
0A694159132AEDAB00558D76 /* wdiag.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6213204FE40031949A /* wdiag.c */; };
0A69415A132AEDAB00558D76 /* adap.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4013213C15008DDA0B /* adap.c */; };
0A69415B132AEDAB00558D76 /* strings.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6313204FE40031949A /* strings.c */; };
0A69415C132AEDAB00558D76 /* pout.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4F132150D9008DDA0B /* pout.c */; };
0A69415D132AEDAB00558D76 /* dist.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4313213C49008DDA0B /* dist.c */; };
0A69415E132AEDAB00558D76 /* startlf.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6413204FE40031949A /* startlf.c */; };
0A69415F132AEDAB00558D76 /* band.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4C13213D03008DDA0B /* band.c */; };
0A694160132AEDAB00558D76 /* lfd.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4913213CDE008DDA0B /* lfd.c */; };
0A694161132AEDAB00558D76 /* readfile.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F5B132158CA008DDA0B /* readfile.c */; };
0A694162132AEDAB00558D76 /* makecmd.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F521321520A008DDA0B /* makecmd.c */; };
0A694163132AEDAB00558D76 /* random.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4613213CAE008DDA0B /* random.c */; };
0A694164132AEDAB00558D76 /* help.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F5513215828008DDA0B /* help.c */; };
0A694165132AEDAB00558D76 /* c_plot.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F581321587C008DDA0B /* c_plot.c */; };
0A694166132AEDAB00558D76 /* solve.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6513204FE40031949A /* solve.c */; };
0A694167132AEDAB00558D76 /* simul.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6613204FE40031949A /* simul.c */; };
0A694168132AEDAB00558D76 /* preplot.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6713204FE40031949A /* preplot.c */; };
0A694169132AEDAB00558D76 /* pcomp.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6813204FE40031949A /* pcomp.c */; };
0A69416A132AEDAC00558D76 /* nbhd.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6913204FE40031949A /* nbhd.c */; };
0A69416B132AEDAC00558D76 /* math.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6A13204FE40031949A /* math.c */; };
0A69416C132AEDAC00558D76 /* m_max.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6B13204FE40031949A /* m_max.c */; };
0A69416D132AEDAC00558D76 /* m_eigen.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6C13204FE40031949A /* m_eigen.c */; };
0A69416E132AEDAC00558D76 /* linalg.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6D13204FE40031949A /* linalg.c */; };
0A69416F132AEDAC00558D76 /* lfstr.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6E13204FE40031949A /* lfstr.c */; };
0A694170132AEDAC00558D76 /* lf_vari.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6F13204FE40031949A /* lf_vari.c */; };
0A694171132AEDAC00558D76 /* lf_fitfun.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7013204FE50031949A /* lf_fitfun.c */; };
0A694172132AEDAC00558D76 /* lf_dercor.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7113204FE50031949A /* lf_dercor.c */; };
0A694173132AEDAC00558D76 /* frend.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7213204FE50031949A /* frend.c */; };
0A694174132AEDAC00558D76 /* fitted.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7313204FE50031949A /* fitted.c */; };
0A694175132AEDAC00558D76 /* family.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7413204FE50031949A /* family.c */; };
0A694176132AEDAC00558D76 /* ev_trian.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7513204FE50031949A /* ev_trian.c */; };
0A694177132AEDAC00558D76 /* ev_main.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7613204FE50031949A /* ev_main.c */; };
0A694178132AEDAC00558D76 /* ev_kdtre.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7713204FE50031949A /* ev_kdtre.c */; };
0A694179132AEDAC00558D76 /* scb.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7813204FE60031949A /* scb.c */; };
0A69417A132AEDAC00558D76 /* scb_cons.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7A13204FE60031949A /* scb_cons.c */; };
0A69417C132AEDAC00558D76 /* m_jacob.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7D13204FE60031949A /* m_jacob.c */; };
0A694181132AEDAC00558D76 /* lf_robust.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8313204FE80031949A /* lf_robust.c */; };
0A694182132AEDAC00558D76 /* m_chol.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8413204FE80031949A /* m_chol.c */; };
0A694184132AEDAC00558D76 /* arith.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8913204FE90031949A /* arith.c */; };
0A694185132AEDAC00558D76 /* c_args.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8A13204FE90031949A /* c_args.c */; };
0A694186132AEDAC00558D76 /* ar_funs.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8B13204FE90031949A /* ar_funs.c */; };
0A694189132AEDAC00558D76 /* cmd.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5913204F180031949A /* cmd.c */; };
0A87350314118DD700E28429 /* libboost_thread-mt.a in Frameworks */ = {isa = PBXBuildFile; fileRef = 0A87350214118DD700E28429 /* libboost_thread-mt.a */; };
0A9291D5132AD37100E7B024 /* replicates.cpp in Sources */ = {isa = PBXBuildFile; fileRef = ED677C0D132A3D83000CFDC8 /* replicates.cpp */; };
9C31043215250D8600F56669 /* jensen_shannon.cpp in Sources */ = {isa = PBXBuildFile; fileRef = EDFE39FA122BE7B700F24CD3 /* jensen_shannon.cpp */; };
9CBCD9B41333EB5B0059FE74 /* multireads.cpp in Sources */ = {isa = PBXBuildFile; fileRef = 0A6183711324308800EFF9AF /* multireads.cpp */; };
9CBCD9B51333ECCE0059FE74 /* replicates.cpp in Sources */ = {isa = PBXBuildFile; fileRef = ED677C0D132A3D83000CFDC8 /* replicates.cpp */; };
9CBCD9B61333ECF50059FE74 /* dens_haz.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F3613213B19008DDA0B /* dens_haz.c */; };
9CBCD9B71333ECF50059FE74 /* dens_int.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F3713213B19008DDA0B /* dens_int.c */; };
9CBCD9B81333ECF50059FE74 /* dens_odi.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F3813213B19008DDA0B /* dens_odi.c */; };
9CBCD9B91333ECF50059FE74 /* vari.cpp in Sources */ = {isa = PBXBuildFile; fileRef = ED920F3313213903008DDA0B /* vari.cpp */; };
9CBCD9BA1333ECF50059FE74 /* density.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F30132137F4008DDA0B /* density.c */; };
9CBCD9BB1333ECF50059FE74 /* minmax.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5D13204FE30031949A /* minmax.c */; };
9CBCD9BC1333ECF50059FE74 /* locfit.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5E13204FE30031949A /* locfit.c */; };
9CBCD9BD1333ECF50059FE74 /* ev_interp.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5F13204FE30031949A /* ev_interp.c */; };
9CBCD9BE1333ECF50059FE74 /* ev_atree.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6013204FE30031949A /* ev_atree.c */; };
9CBCD9BF1333ECF50059FE74 /* weight.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6113204FE30031949A /* weight.c */; };
9CBCD9C01333ECF50059FE74 /* wdiag.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6213204FE40031949A /* wdiag.c */; };
9CBCD9C11333ECF50059FE74 /* adap.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4013213C15008DDA0B /* adap.c */; };
9CBCD9C21333ECF50059FE74 /* strings.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6313204FE40031949A /* strings.c */; };
9CBCD9C31333ECF50059FE74 /* pout.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4F132150D9008DDA0B /* pout.c */; };
9CBCD9C41333ECF50059FE74 /* dist.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4313213C49008DDA0B /* dist.c */; };
9CBCD9C51333ECF50059FE74 /* startlf.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6413204FE40031949A /* startlf.c */; };
9CBCD9C61333ECF50059FE74 /* band.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4C13213D03008DDA0B /* band.c */; };
9CBCD9C71333ECF50059FE74 /* lfd.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4913213CDE008DDA0B /* lfd.c */; };
9CBCD9C81333ECF50059FE74 /* readfile.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F5B132158CA008DDA0B /* readfile.c */; };
9CBCD9C91333ECF50059FE74 /* makecmd.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F521321520A008DDA0B /* makecmd.c */; };
9CBCD9CA1333ECF50059FE74 /* random.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F4613213CAE008DDA0B /* random.c */; };
9CBCD9CB1333ECF50059FE74 /* help.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F5513215828008DDA0B /* help.c */; };
9CBCD9CC1333ECF50059FE74 /* c_plot.c in Sources */ = {isa = PBXBuildFile; fileRef = ED920F581321587C008DDA0B /* c_plot.c */; };
9CBCD9CD1333ECF50059FE74 /* solve.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6513204FE40031949A /* solve.c */; };
9CBCD9CE1333ECF50059FE74 /* simul.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6613204FE40031949A /* simul.c */; };
9CBCD9CF1333ECF50059FE74 /* preplot.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6713204FE40031949A /* preplot.c */; };
9CBCD9D01333ECF50059FE74 /* pcomp.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6813204FE40031949A /* pcomp.c */; };
9CBCD9D11333ECF50059FE74 /* nbhd.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6913204FE40031949A /* nbhd.c */; };
9CBCD9D21333ECF50059FE74 /* math.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6A13204FE40031949A /* math.c */; };
9CBCD9D31333ECF50059FE74 /* m_max.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6B13204FE40031949A /* m_max.c */; };
9CBCD9D41333ECF50059FE74 /* m_eigen.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6C13204FE40031949A /* m_eigen.c */; };
9CBCD9D51333ECF50059FE74 /* linalg.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6D13204FE40031949A /* linalg.c */; };
9CBCD9D61333ECF50059FE74 /* lfstr.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6E13204FE40031949A /* lfstr.c */; };
9CBCD9D71333ECF50059FE74 /* lf_vari.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6F13204FE40031949A /* lf_vari.c */; };
9CBCD9D81333ECF50059FE74 /* lf_fitfun.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7013204FE50031949A /* lf_fitfun.c */; };
9CBCD9D91333ECF50059FE74 /* lf_dercor.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7113204FE50031949A /* lf_dercor.c */; };
9CBCD9DA1333ECF50059FE74 /* frend.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7213204FE50031949A /* frend.c */; };
9CBCD9DB1333ECF50059FE74 /* fitted.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7313204FE50031949A /* fitted.c */; };
9CBCD9DC1333ECF50059FE74 /* family.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7413204FE50031949A /* family.c */; };
9CBCD9DD1333ECF50059FE74 /* ev_trian.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7513204FE50031949A /* ev_trian.c */; };
9CBCD9DE1333ECF50059FE74 /* ev_main.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7613204FE50031949A /* ev_main.c */; };
9CBCD9DF1333ECF50059FE74 /* ev_kdtre.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7713204FE50031949A /* ev_kdtre.c */; };
9CBCD9E01333ECF50059FE74 /* scb.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7813204FE60031949A /* scb.c */; };
9CBCD9E11333ECF50059FE74 /* scb_cons.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7A13204FE60031949A /* scb_cons.c */; };
9CBCD9E21333ECFD0059FE74 /* m_jacob.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B7D13204FE60031949A /* m_jacob.c */; };
9CBCD9E31333ECFD0059FE74 /* lf_robust.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8313204FE80031949A /* lf_robust.c */; };
9CBCD9E41333ECFD0059FE74 /* m_chol.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8413204FE80031949A /* m_chol.c */; };
9CBCD9E51333ECFD0059FE74 /* arith.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8913204FE90031949A /* arith.c */; };
9CBCD9E61333ECFD0059FE74 /* c_args.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8A13204FE90031949A /* c_args.c */; };
9CBCD9E71333ECFD0059FE74 /* ar_funs.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B8B13204FE90031949A /* ar_funs.c */; };
9CBCD9E81333ECFD0059FE74 /* cmd.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5913204F180031949A /* cmd.c */; };
9CCF1F3C135E29D600D7D6BD /* minmax.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5D13204FE30031949A /* minmax.c */; };
9CCF1F3D135E29D600D7D6BD /* locfit.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5E13204FE30031949A /* locfit.c */; };
9CCF1F3E135E29D600D7D6BD /* ev_interp.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B5F13204FE30031949A /* ev_interp.c */; };
9CCF1F3F135E29D600D7D6BD /* ev_atree.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6013204FE30031949A /* ev_atree.c */; };
9CCF1F40135E29D600D7D6BD /* weight.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6113204FE30031949A /* weight.c */; };
9CCF1F41135E29D600D7D6BD /* wdiag.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6213204FE40031949A /* wdiag.c */; };
9CCF1F42135E29D600D7D6BD /* strings.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6313204FE40031949A /* strings.c */; };
9CCF1F43135E29D600D7D6BD /* startlf.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6413204FE40031949A /* startlf.c */; };
9CCF1F44135E29D600D7D6BD /* solve.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6513204FE40031949A /* solve.c */; };
9CCF1F45135E29D600D7D6BD /* simul.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6613204FE40031949A /* simul.c */; };
9CCF1F46135E29D700D7D6BD /* preplot.c in Sources */ = {isa = PBXBuildFile; fileRef = 9CC50B6713204FE40031949
gitextract_l5aioowe/ ├── .gitignore ├── AUTHORS ├── LICENSE ├── Makefile.am ├── README.md ├── autogen.sh ├── ax_bam.m4 ├── ax_boost_base.m4 ├── ax_boost_filesystem.m4 ├── ax_boost_serialization.m4 ├── ax_boost_system.m4 ├── ax_boost_thread.m4 ├── ax_check_eigen.m4 ├── ax_check_zlib.m4 ├── ax_openmp.m4 ├── boost.m4 ├── configure.ac ├── cufflinks.xcodeproj/ │ ├── cole.pbxuser │ ├── cole.perspectivev3 │ └── project.pbxproj ├── doc/ │ ├── CL_figure_scratch.doc │ ├── CL_main_text.doc │ ├── CL_supplement.tex │ ├── CL_versions.tex │ ├── Cartoons.pptx │ ├── Paper Outline.doc │ ├── algorithm/ │ │ ├── algorithm.bib │ │ ├── algorithm.tex │ │ └── homework.cls │ ├── cufflinks.bib │ ├── html/ │ │ ├── css/ │ │ │ └── style.css │ │ ├── downloads/ │ │ │ └── test_data.sam │ │ ├── faq.html │ │ ├── gff.html │ │ ├── howitworks.html │ │ ├── igenome/ │ │ │ └── igenome_table.py │ │ ├── igenomes.html │ │ ├── images/ │ │ │ └── ucsc-track.tiff │ │ ├── index.html │ │ ├── manual.html │ │ ├── site.tmproj │ │ └── tutorial.html │ └── illustrator/ │ └── Fig 2 - Tuxedo Workflow.ai ├── external_tests/ │ └── tiny_tests/ │ └── 2x75/ │ ├── accepted_hits.sam │ └── test_ref.fa ├── index.md ├── make_bin.sh ├── src/ │ ├── GArgs.cpp │ ├── GArgs.h │ ├── GBase.cpp │ ├── GBase.h │ ├── GFaSeqGet.cpp │ ├── GFaSeqGet.h │ ├── GFastaIndex.cpp │ ├── GFastaIndex.h │ ├── GHash.hh │ ├── GList.hh │ ├── GStr.cpp │ ├── GStr.h │ ├── GVec.hh │ ├── LICENSE │ ├── Makefile.am │ ├── abundances.cpp │ ├── abundances.h │ ├── assemble.cpp │ ├── assemble.h │ ├── biascorrection.cpp │ ├── biascorrection.h │ ├── bundles.cpp │ ├── bundles.h │ ├── clustering.cpp │ ├── clustering.h │ ├── codons.cpp │ ├── codons.h │ ├── common.cpp │ ├── common.h │ ├── compress_gtf.cpp │ ├── cuffcluster.cpp │ ├── cuffcompare.cpp │ ├── cuffdiff.cpp │ ├── cuffdiff_to_gct.py │ ├── cufflinks.cpp │ ├── cufflinks.xcodeproj/ │ │ ├── cole.pbxuser │ │ ├── cole.perspectivev3 │ │ └── project.pbxproj │ ├── cuffmerge │ ├── cuffnorm.cpp │ ├── cuffquant.cpp │ ├── differential.cpp │ ├── differential.h │ ├── filters.cpp │ ├── filters.h │ ├── gdna.cpp │ ├── gdna.h │ ├── genes.cpp │ ├── genes.h │ ├── gff.cpp │ ├── gff.h │ ├── gff_utils.cpp │ ├── gff_utils.h │ ├── gffread.cpp │ ├── graph_optimize.cpp │ ├── graph_optimize.h │ ├── gtf_reads.cpp │ ├── gtf_to_sam.cpp │ ├── gtf_tracking.cpp │ ├── gtf_tracking.h │ ├── hits.cpp │ ├── hits.h │ ├── jensen_shannon.cpp │ ├── jensen_shannon.h │ ├── lemon/ │ │ ├── bfs.h │ │ ├── bin_heap.h │ │ ├── bipartite_matching.h │ │ ├── bits/ │ │ │ ├── alteration_notifier.h │ │ │ ├── array_map.h │ │ │ ├── base_extender.h │ │ │ ├── debug_map.h │ │ │ ├── default_map.h │ │ │ ├── graph_adaptor_extender.h │ │ │ ├── graph_extender.h │ │ │ ├── invalid.h │ │ │ ├── map_extender.h │ │ │ ├── path_dump.h │ │ │ ├── traits.h │ │ │ ├── utility.h │ │ │ ├── variant.h │ │ │ └── vector_map.h │ │ ├── bucket_heap.h │ │ ├── concept_check.h │ │ ├── concepts/ │ │ │ ├── bpugraph.h │ │ │ ├── graph.h │ │ │ ├── graph_components.h │ │ │ ├── heap.h │ │ │ ├── maps.h │ │ │ ├── matrix_maps.h │ │ │ ├── path.h │ │ │ └── ugraph.h │ │ ├── dfs.h │ │ ├── error.h │ │ ├── fib_heap.h │ │ ├── graph_adaptor.h │ │ ├── graph_utils.h │ │ ├── list_graph.h │ │ ├── maps.h │ │ ├── math.h │ │ ├── smart_graph.h │ │ ├── tolerance.h │ │ └── topology.h │ ├── locfit/ │ │ ├── adap.c │ │ ├── ar_funs.c │ │ ├── arith.c │ │ ├── band.c │ │ ├── c_args.c │ │ ├── c_plot.c │ │ ├── cmd.c │ │ ├── dens_haz.c │ │ ├── dens_int.c │ │ ├── dens_odi.c │ │ ├── density.c │ │ ├── design.h │ │ ├── dist.c │ │ ├── ev_atree.c │ │ ├── ev_interp.c │ │ ├── ev_kdtre.c │ │ ├── ev_main.c │ │ ├── ev_trian.c │ │ ├── family.c │ │ ├── fitted.c │ │ ├── frend.c │ │ ├── help.c │ │ ├── imatlb.h │ │ ├── lf_dercor.c │ │ ├── lf_fitfun.c │ │ ├── lf_robust.c │ │ ├── lf_vari.c │ │ ├── lfcons.h │ │ ├── lfd.c │ │ ├── lffuns.h │ │ ├── lfstr.c │ │ ├── lfstruc.h │ │ ├── lfwin.h │ │ ├── linalg.c │ │ ├── local.h │ │ ├── locfit.c │ │ ├── m_chol.c │ │ ├── m_eigen.c │ │ ├── m_jacob.c │ │ ├── m_max.c │ │ ├── makecmd.c │ │ ├── math.c │ │ ├── minmax.c │ │ ├── mutil.h │ │ ├── nbhd.c │ │ ├── pcomp.c │ │ ├── pout.c │ │ ├── preplot.c │ │ ├── random.c │ │ ├── readfile.c │ │ ├── scb.c │ │ ├── scb_cons.c │ │ ├── simul.c │ │ ├── solve.c │ │ ├── startlf.c │ │ ├── strings.c │ │ ├── vari.cpp │ │ ├── vari.hpp │ │ ├── wdiag.c │ │ └── weight.c │ ├── matching_merge.cpp │ ├── matching_merge.h │ ├── multireads.cpp │ ├── multireads.h │ ├── negative_binomial_distribution.h │ ├── progressbar.h │ ├── replicates.cpp │ ├── replicates.h │ ├── rounding.h │ ├── sampling.cpp │ ├── sampling.h │ ├── scaffold_graph.cpp │ ├── scaffold_graph.h │ ├── scaffolds.cpp │ ├── scaffolds.h │ ├── tokenize.cpp │ ├── tokenize.h │ ├── tracking.cpp │ ├── tracking.h │ ├── transitive_closure.h │ ├── transitive_reduction.h │ └── update_check.h ├── tests/ │ └── unit_tests/ │ ├── test_abundances.cpp │ ├── test_main.cpp │ └── test_scaffolds.cpp └── version.m4
Showing preview only (204K chars total). Download the full file or copy to clipboard to get everything.
SYMBOL INDEX (2758 symbols across 167 files)
FILE: doc/html/igenome/igenome_table.py
function generate_table (line 26) | def generate_table():
FILE: src/GArgs.h
type GArgsDef (line 21) | struct GArgsDef {
function class (line 28) | class GArgs {
FILE: src/GBase.cpp
function GAssert (line 54) | void GAssert(const char* expression, const char* filename, unsigned int ...
function GError (line 66) | void GError(const char* format,...){
function GMessage (line 91) | void GMessage(const char* format,...){
function GMalloc (line 111) | bool GMalloc(pointer* ptr,unsigned long size){
function GCalloc (line 118) | bool GCalloc(pointer* ptr,unsigned long size){
function GRealloc (line 125) | bool GRealloc(pointer* ptr,unsigned long size){
function GFree (line 149) | void GFree(pointer* ptr){
function Gstrcmp (line 180) | int Gstrcmp(const char* a, const char* b, int n) {
function G_mkdir (line 191) | int G_mkdir(const char* path, int perms=0775) {
function Gmkdir (line 204) | int Gmkdir(const char *path, bool recursive, int perms) {
function GstrEq (line 235) | bool GstrEq(const char* a, const char* b) {
function GstriEq (line 245) | bool GstriEq(const char* a, const char* b) {
function Gstricmp (line 254) | int Gstricmp(const char* a, const char* b, int n) {
function strsplit (line 279) | int strsplit(char* str, char** fields, int maxfields, const char* delim) {
function strsplit (line 303) | int strsplit(char* str, char** fields, int maxfields, const char delim) {
function strsplit (line 327) | int strsplit(char* str, char** fields, int maxfields) {
function chrInStr (line 523) | bool chrInStr(char c, const char* str) {
function startsWith (line 571) | bool startsWith(const char* s, const char* prefix) {
function startsiWith (line 578) | bool startsiWith(const char* s, const char* prefix) {
function endsWith (line 587) | bool endsWith(const char* s, const char* suffix) {
function strhash (line 629) | int strhash(const char* str){
function delFileName (line 645) | void delFileName(char* filepath) {
function fileExists (line 674) | int fileExists(const char* fname) {
function int64 (line 701) | int64 fileSize(const char* fpath) {
function parseNumber (line 712) | bool parseNumber(char* &p, double& v) {
function parseDouble (line 735) | bool parseDouble(char* &p, double& v) {
function parseInt (line 739) | bool parseInt(char* &p, int& i) {
function parseUInt (line 757) | bool parseUInt(char* &p, uint& i) {
function parseHex (line 775) | bool parseHex(char* &p, uint& i) {
function writeFasta (line 795) | void writeFasta(FILE *fw, const char* seqid, const char* descr,
FILE: src/GBase.h
type int32 (line 68) | typedef int32_t int32;
type uint32 (line 69) | typedef uint32_t uint32;
type int16 (line 70) | typedef int16_t int16;
type uint16 (line 71) | typedef uint16_t uint16;
type uchar (line 73) | typedef unsigned char uchar;
type byte (line 74) | typedef unsigned char byte;
type int64 (line 92) | typedef int64_t int64;
type uint64 (line 93) | typedef uint64_t uint64;
type uint (line 145) | typedef unsigned int uint;
type pointer (line 149) | typedef pointer GFLoadProc(FILE* fstorage);
function iround (line 170) | inline int iround(double x) {
function Gintcmp (line 179) | inline int Gintcmp(int a, int b) {
function class (line 286) | class GSeg {
function operator (line 348) | bool operator==(GSeg& d){
function operator (line 351) | bool operator<(GSeg& d){
function class (line 362) | class GLineReader {
FILE: src/GFaSeqGet.h
function class (line 8) | class GSubSeq {
function class (line 41) | class GFaSeqGet {
function load (line 121) | void load(uint cstart, uint cend) {
function getsublen (line 127) | int getsublen() { return lastsub!=NULL ? lastsub->sqlen : 0 ; }
function getseqlen (line 128) | int getseqlen() { return seq_len; }
function off_t (line 129) | off_t getseqofs() { return fseqstart; }
function getLineLen (line 130) | int getLineLen() { return line_len; }
function getLineBLen (line 131) | int getLineBLen() { return line_blen; }
FILE: src/GFastaIndex.h
function class (line 14) | class GFastaRec {
function d (line 28) | bool operator==(GFastaRec& d){
function d (line 31) | bool operator>(GFastaRec& d){
function d (line 34) | bool operator<(GFastaRec& d){
function class (line 40) | class GFastaIndex {
FILE: src/GHash.hh
class GHash (line 15) | class GHash {
type GHashEntry (line 17) | struct GHashEntry {
method OBJ (line 33) | OBJ* Data(uint pos) const { return (OBJ*) hash[pos].data; }
method Mark (line 35) | bool Mark(uint pos) const { return hash[pos].mark; }
method DefaultFreeProc (line 54) | static void DefaultFreeProc(pointer item) {
method setFreeItem (line 60) | void setFreeItem(GFreeProc *freeProc) { fFreeProc=freeProc; }
method setFreeItem (line 61) | void setFreeItem(bool doFree) { fFreeProc=(doFree)? &DefaultFreeProc :...
method Capacity (line 62) | int Capacity() const { return fCapacity; }
method Count (line 64) | int Count() const { return fCount; }
method OBJ (line 82) | OBJ* operator[](const char* ky) { return Find(ky); }
method GHashEntry (line 89) | GHashEntry* NextEntry() { //returns a pointer to a GHashEntry
function OBJ (line 200) | const OBJ* GHash<OBJ>::Add(const char* ky,
function OBJ (line 241) | const OBJ* GHash<OBJ>::shkAdd(const char* ky,
function OBJ (line 284) | OBJ* GHash<OBJ>::Replace(const char* ky,const OBJ* pdata, bool mrk){
function OBJ (line 326) | OBJ* GHash<OBJ>::Remove(const char* ky){
function OBJ (line 386) | OBJ* GHash<OBJ>::Find(const char* ky, char** keyptr){
function OBJ (line 428) | OBJ* GHash<OBJ>::NextData() {
function OBJ (line 442) | OBJ* GHash<OBJ>::NextData(char* &nextkey) {
FILE: src/GList.hh
class GArray (line 21) | class GArray:public GVec<OBJ> {
method DefaultCompareProc (line 24) | static int DefaultCompareProc(const pointer item1, const pointer item2) {
method setSorted (line 40) | void setSorted(bool sorted) {
method Add (line 51) | int Add(OBJ& item) { return Add(&item); }
method cAdd (line 53) | int cAdd(OBJ item) { return Add(&item); }
method cPush (line 54) | int cPush(OBJ item) { return Add(&item); }
method Push (line 55) | int Push(OBJ& item) { return Add(&item); }
method setUnique (line 59) | void setUnique(bool beUnique) { fUnique = beUnique; }
method Sorted (line 61) | bool Sorted() { return fCompareProc!=NULL; }
method Unique (line 63) | int Unique() { return fUnique; }
method Insert (line 73) | void Insert(int idx, OBJ item) { Insert(idx,&item); }
class GList (line 77) | class GList:public GPVec<OBJ> {
method DefaultCompareProc (line 82) | static int DefaultCompareProc(const pointer item1, const pointer item2) {
method Sorted (line 104) | bool Sorted() { return fCompareProc!=NULL; }
method setSorted (line 105) | void setSorted(bool sorted) {
method Unique (line 127) | int Unique() { return fUnique; }
method setUnique (line 129) | void setUnique(bool beUnique) { fUnique = beUnique; }
method GCompareProc (line 131) | GCompareProc* GetCompareProc() {return fCompareProc;}
function OBJ (line 487) | OBJ* GList<OBJ>::AddIfNew(OBJ* item,
FILE: src/GStr.cpp
function GStr (line 191) | GStr& GStr::operator=(const GStr& s) {
function GStr (line 197) | GStr& GStr::operator=(const char *s) {
function GStr (line 208) | GStr& GStr::operator=(const double f) {
function GStr (line 218) | GStr& GStr::operator=(const int i) {
function GStr (line 290) | GStr& GStr::append(char c) {
function GStr (line 296) | GStr& GStr::append(int i) {
function GStr (line 302) | GStr& GStr::append(uint i) {
function GStr (line 308) | GStr& GStr::append(long l) {
function GStr (line 314) | GStr& GStr::append(unsigned long l) {
function GStr (line 320) | GStr& GStr::append(double f) {
function GStr (line 331) | GStr GStr::copy() const {
function GStr (line 336) | GStr& GStr::clear() {
function GStr (line 378) | GStr& GStr::format(const char *fmt,...) {
function GStr (line 395) | GStr& GStr::appendfmt(const char *fmt,...) {
function GStr (line 410) | GStr& GStr::trim(char c) {
function GStr (line 430) | GStr& GStr::trim(const char* c) {
function GStr (line 449) | GStr& GStr::trimR(char c) {
function GStr (line 469) | GStr& GStr::trimR(const char* c) {
function GStr (line 487) | GStr& GStr::chomp(const char* cstr) {
function GStr (line 510) | GStr& GStr::trimL(char c) {
function GStr (line 527) | GStr& GStr::trimL(const char* c) {
function GStr (line 545) | GStr& GStr::padR(int len, char c) {
function GStr (line 556) | GStr& GStr::padL(int len, char c) { //align left the string
function GStr (line 566) | GStr& GStr::padC(int len, char c) {
function GStr (line 581) | GStr operator+(const char *s1, const GStr& s2) {
function GStr (line 597) | GStr GStr::operator+(const GStr& s) const {
function GStr (line 613) | GStr GStr::operator+(const char *s) const {
function GStr (line 628) | GStr GStr::operator+(const int i) const {
function GStr (line 639) | GStr GStr::operator+(const char c) const {
function GStr (line 650) | GStr GStr::operator+(const double f) const {
function GStr (line 678) | GStr GStr::substr(int idx, int len) const {
function GStr (line 696) | GStr& GStr::reverse() {
function GStr (line 714) | GStr& GStr::tr(const char *rfrom, const char* rto) {
function GStr (line 755) | GStr& GStr::replace(const char *rfrom, const char* rto) {
function GStr (line 809) | GStr& GStr::cut(int idx, int len) {
function GStr (line 838) | GStr& GStr::paste(const GStr& s, int idx, int len) {
function GStr (line 868) | GStr& GStr::paste(const char *s, int idx, int len) {
function GStr (line 901) | GStr& GStr::insert(const GStr& s, int idx) {
function GStr (line 925) | GStr& GStr::insert(const char *s, int idx) {
function GStr (line 949) | GStr& GStr::append(const char* s) {
function GStr (line 967) | GStr& GStr::append(const GStr& s) {
function GStr (line 972) | GStr& GStr::upper() {
function GStr (line 982) | GStr& GStr::lower() {
function GStr (line 1054) | GStr GStr::split(const char* delim) {
function GStr (line 1071) | GStr GStr::split(char c) {
function GStr (line 1088) | GStr GStr::splitr(const char* delim) {
function GStr (line 1099) | GStr GStr::splitr(char c) {
function GStr (line 1322) | GStr GStr::to(char c) { //return the first part up to first occurence of c
function GStr (line 1328) | GStr GStr::from(char c) { //same as to, but starting from the right side
FILE: src/GStr.h
type enTokenizeMode (line 16) | enum enTokenizeMode {
function class (line 21) | class GStr {
function is_empty (line 73) | bool is_empty() const;
function asDouble (line 114) | double asDouble() { return asReal(); }
function asDouble (line 116) | bool asDouble(double& r) { return asReal(r); }
function Gswap (line 218) | inline void Gswap(GStr& s1, GStr& s2) {
FILE: src/GVec.hh
type IsPrimitiveType (line 26) | struct IsPrimitiveType {
type IsPrimitiveType<bool> (line 30) | struct IsPrimitiveType<bool> { enum { VAL = 1 }; }
type IsPrimitiveType<void*> (line 31) | struct IsPrimitiveType<void*> { enum { VAL = 1 }; }
type IsPrimitiveType<char*> (line 32) | struct IsPrimitiveType<char*> { enum { VAL = 1 }; }
type IsPrimitiveType<float> (line 33) | struct IsPrimitiveType<float> { enum { VAL = 1 }; }
type IsPrimitiveType<double> (line 34) | struct IsPrimitiveType<double> { enum { VAL = 1 }; }
type IsPrimitiveType<int> (line 36) | struct IsPrimitiveType<int> { enum { VAL = 1 }; }
type IsPrimitiveType<unsigned int> (line 37) | struct IsPrimitiveType<unsigned int> { enum { VAL = 1 }; }
type IsPrimitiveType<char> (line 38) | struct IsPrimitiveType<char> { enum { VAL = 1 }; }
type IsPrimitiveType<unsigned char> (line 39) | struct IsPrimitiveType<unsigned char> { enum { VAL = 1 }; }
type IsPrimitiveType<short> (line 40) | struct IsPrimitiveType<short> { enum { VAL = 1 }; }
type IsPrimitiveType<unsigned short> (line 41) | struct IsPrimitiveType<unsigned short> { enum { VAL = 1 }; }
type IsPrimitiveType<long> (line 42) | struct IsPrimitiveType<long> { enum { VAL = 1 }; }
type IsPrimitiveType<unsigned long> (line 43) | struct IsPrimitiveType<unsigned long> { enum { VAL = 1 }; }
type IsPrimitiveType<long long> (line 44) | struct IsPrimitiveType<long long> { enum { VAL = 1 }; }
type IsPrimitiveType<unsigned long long> (line 45) | struct IsPrimitiveType<unsigned long long> { enum { VAL = 1 }; }
function DefLTCompareProc (line 59) | int DefLTCompareProc(const pointer p1, const pointer p2) {
class GVec (line 68) | class GVec {
method Insert (line 81) | void Insert(int idx, OBJ item) { Insert(idx, &item); }
method idxInsert (line 83) | void idxInsert(int idx, OBJ& item) { Insert(idx, &item); }
method Add (line 88) | int Add(OBJ& item) { return Add(&item); }
method cAdd (line 89) | int cAdd(OBJ item) { return Add(&item); }
method Push (line 93) | int Push(OBJ& item) { return Add(&item); }
method cPush (line 94) | int cPush(OBJ item) { return Add(&item); }
method OBJ (line 100) | OBJ& Get(int idx) {
method OBJ (line 104) | inline OBJ& operator[](int i) {
method OBJ (line 108) | OBJ& Last() {
method OBJ (line 112) | OBJ& First() {
method Swap (line 120) | void Swap(int idx1, int idx2) { Exchange(idx1, idx2); }
method Capacity (line 121) | int Capacity() { return fCapacity; }
method Count (line 124) | int Count() { return fCount; }
method Resize (line 129) | void Resize(int NewCount) { setCount(NewCount); }
method Resize (line 131) | void Resize(int NewCount, OBJ v) { setCount(NewCount, &v); }
method isEmpty (line 134) | bool isEmpty() { return fCount==0; }
method notEmpty (line 135) | bool notEmpty() { return fCount>0; }
class GPVec (line 143) | class GPVec {
method DefaultFreeProc (line 155) | static void DefaultFreeProc(pointer item) {
method OBJ (line 165) | OBJ* operator[](int i) { return this->Get(i); }
method setFreeItem (line 169) | void setFreeItem(GFreeProc *freeProc) { fFreeProc=freeProc; }
method setFreeItem (line 170) | void setFreeItem(bool doFree) {
method Push (line 175) | int Push(OBJ* item) { return Add(item); }
method Swap (line 181) | void Swap(int idx1, int idx2) { Exchange(idx1, idx2); }
method OBJ (line 182) | OBJ* First() { return (fCount>0)?fList[0]:NULL; }
method OBJ (line 183) | OBJ* Last() { return (fCount>0)?fList[fCount-1]:NULL;}
method isEmpty (line 184) | bool isEmpty() { return fCount==0; }
method notEmpty (line 185) | bool notEmpty() { return fCount>0; }
method Capacity (line 186) | int Capacity() { return fCapacity; }
method Count (line 187) | int Count() { return fCount; }
function OBJ (line 410) | OBJ GVec<OBJ>::Pop() {
function OBJ (line 420) | OBJ GVec<OBJ>::Shift() {
function OBJ (line 696) | OBJ* GPVec<OBJ>::Get(int idx) {
function OBJ (line 833) | OBJ* GPVec<OBJ>::Pop() {
function OBJ (line 842) | OBJ* GPVec<OBJ>::Shift() {
FILE: src/abundances.cpp
function digamma (line 85) | double digamma(double x)
function trigamma (line 178) | double trigamma(double x)
function negbin_log_likelihood (line 232) | long double negbin_log_likelihood(const vector<double>& samples, long do...
function poisson_log_likelihood (line 267) | long double poisson_log_likelihood(const vector<double>& samples, long d...
function negbin_log_likelihood_helper (line 290) | long double negbin_log_likelihood_helper(const vector<double>& samples, ...
function negbin_log_likelihood_prime_helper (line 334) | long double negbin_log_likelihood_prime_helper(const vector<double>& sam...
type negbin_ll_functor (line 357) | struct negbin_ll_functor
method negbin_ll_functor (line 359) | negbin_ll_functor(const vector<double>& count_samples) : samples(count...
function fit_negbin_dist (line 371) | bool fit_negbin_dist(const vector<double> samples, double& r, double& p)
function compute_compatibilities (line 420) | void compute_compatibilities(const vector<boost::shared_ptr<Abundance> >...
function AbundanceStatus (line 524) | AbundanceStatus AbundanceGroup::status() const
function BOOST_FOREACH (line 564) | BOOST_FOREACH(boost::shared_ptr<Abundance> ab, _abundances)
function BOOST_FOREACH (line 578) | BOOST_FOREACH(boost::shared_ptr<Abundance> ab, _abundances)
function CountPerReplicateTable (line 586) | CountPerReplicateTable AbundanceGroup::num_fragments_by_replicate() const
function FPKMPerReplicateTable (line 614) | FPKMPerReplicateTable AbundanceGroup::FPKM_by_replicate() const
function StatusPerReplicateTable (line 638) | StatusPerReplicateTable AbundanceGroup::status_by_replicate() const
function BOOST_FOREACH (line 688) | BOOST_FOREACH(boost::shared_ptr<Abundance> ab, _abundances)
function BOOST_FOREACH (line 727) | BOOST_FOREACH(boost::shared_ptr<Abundance> ab, _abundances)
function BOOST_FOREACH (line 739) | BOOST_FOREACH(boost::shared_ptr<Abundance> ab, _abundances)
function BOOST_FOREACH (line 789) | BOOST_FOREACH(bool keeper, to_keep)
function BOOST_FOREACH (line 858) | BOOST_FOREACH(boost::shared_ptr<Abundance> pA, _abundances)
function BOOST_FOREACH (line 872) | BOOST_FOREACH (boost::shared_ptr<Abundance> pA, _abundances)
function BOOST_FOREACH (line 885) | BOOST_FOREACH (boost::shared_ptr<Abundance> pA, _abundances)
function BOOST_FOREACH (line 899) | BOOST_FOREACH (boost::shared_ptr<Abundance> pA, _abundances)
function BOOST_FOREACH (line 912) | BOOST_FOREACH (boost::shared_ptr<Abundance> pA, _abundances)
function string (line 921) | const string& AbundanceGroup::locus_tag() const
function string (line 945) | const string& AbundanceGroup::reference_tag() const
function BOOST_FOREACH (line 975) | BOOST_FOREACH (boost::shared_ptr<Abundance> ab, _abundances)
function collapse_equivalent_hits (line 1140) | void collapse_equivalent_hits(const vector<MateHit>& alignments,
function collapse_equivalent_hits_helper (line 1360) | void collapse_equivalent_hits_helper(const vector<MateHit>& alignments,
function generate_count_assignment_samples (line 1429) | bool generate_count_assignment_samples(int num_draws,
function calculate_gamma_mle_covariance (line 1518) | void calculate_gamma_mle_covariance(const std::map<boost::shared_ptr<Rea...
function calculate_fragment_assignment_distribution (line 1597) | void calculate_fragment_assignment_distribution(const std::map<boost::sh...
function solve_beta (line 2008) | long double solve_beta(long double A, long double B, long double C)
function estimate_count_variance (line 2043) | bool estimate_count_variance(long double& variance,
function simulate_count_covariance (line 2157) | bool simulate_count_covariance(const vector<double>& num_fragments,
function BOOST_FOREACH (line 2747) | BOOST_FOREACH(boost::shared_ptr<Abundance> pA, _abundances)
function compute_cond_probs_and_effective_lengths (line 2861) | void compute_cond_probs_and_effective_lengths(const vector<MateHit>& ali...
function trace (line 2896) | double trace(const ublas::matrix<double>& m)
function BOOST_FOREACH (line 2919) | BOOST_FOREACH (boost::shared_ptr<Abundance> ab, _abundances)
function BOOST_FOREACH (line 2969) | BOOST_FOREACH (boost::shared_ptr<Abundance> ab, _abundances)
function calculate_assignment_probs (line 3136) | void calculate_assignment_probs(const Eigen::VectorXd& alignment_multipl...
function calculate_average_assignment_probs (line 3168) | void calculate_average_assignment_probs(const Eigen::VectorXd& alignment...
function calculate_iterated_exp_count_covariance (line 3225) | void calculate_iterated_exp_count_covariance(const vector<double>& gammas,
function BOOST_FOREACH (line 3370) | BOOST_FOREACH (boost::shared_ptr<Abundance> pA, _abundances)
function BOOST_FOREACH (line 3379) | BOOST_FOREACH (boost::shared_ptr<Abundance> pA, _abundances)
function get_alignments_from_scaffolds (line 3473) | void get_alignments_from_scaffolds(const vector<boost::shared_ptr<Abunda...
function Estep (line 3506) | void Estep (int N,
function Mstep (line 3607) | void Mstep (int N,
function logLike (line 3630) | double logLike (int N,
function EM (line 3661) | double EM(int N, int M,
function compute_fisher (line 3718) | void compute_fisher(const vector<boost::shared_ptr<Abundance> >& transcr...
function AbundanceStatus (line 3771) | AbundanceStatus compute_posterior_expectation(const vector<ublas::vector...
function AbundanceStatus (line 3842) | AbundanceStatus AbundanceGroup::calculate_per_replicate_abundances(vecto...
function AbundanceStatus (line 3903) | AbundanceStatus calculate_inverse_fisher(const vector<boost::shared_ptr<...
function AbundanceStatus (line 3958) | AbundanceStatus revise_map_mean_and_cov_estimate(double log_total_weight,
function AbundanceStatus (line 4032) | AbundanceStatus calc_is_scale_factor(const ublas::matrix<double>& covari...
function is_identifiable (line 4053) | bool is_identifiable(M &m, PM &pm)
function AbundanceStatus (line 4085) | AbundanceStatus gamma_mle(const vector<boost::shared_ptr<Abundance> >& t...
function calc_isoform_fpkm_conf_intervals (line 4240) | void calc_isoform_fpkm_conf_intervals(double FPKM,
function not_intronic (line 4251) | bool not_intronic(int p, vector<float>& depth_of_coverage, vector<float>...
function compute_doc (line 4261) | double compute_doc(int bundle_origin,
function major_isoform_intron_doc (line 4376) | double major_isoform_intron_doc(map<pair<int, int>, float>& intron_doc)
function record_min_doc_for_scaffolds (line 4418) | void record_min_doc_for_scaffolds(int bundle_origin,
function record_doc_for_scaffolds (line 4437) | void record_doc_for_scaffolds(int bundle_origin,
function record_doc_for_scaffolds (line 4452) | void record_doc_for_scaffolds(int bundle_origin,
function get_intron_doc (line 4471) | double get_intron_doc(const Scaffold& s,
function get_scaffold_doc (line 4503) | double get_scaffold_doc(int bundle_origin,
function get_scaffold_min_doc (line 4526) | double get_scaffold_min_doc(int bundle_origin,
function tss_analysis (line 4549) | void tss_analysis(const string& locus_tag, SampleAbundances& sample)
function cds_analyis (line 4632) | void cds_analyis(const string& locus_tag, SampleAbundances& sample)
function sample_abundance_worker (line 4711) | void sample_abundance_worker(const string& locus_tag,
function merge_precomputed_expression_worker (line 4838) | void merge_precomputed_expression_worker(const string& locus_tag,
FILE: src/abundances.h
type ConfidenceInterval (line 30) | struct ConfidenceInterval
type AbundanceStatus (line 46) | enum AbundanceStatus { NUMERIC_OK, NUMERIC_FAIL, NUMERIC_LOW_DATA, NUMER...
type map (line 48) | typedef map<boost::shared_ptr<ReadGroupProperties const>, double> CountP...
type map (line 49) | typedef map<boost::shared_ptr<ReadGroupProperties const>, double> FPKMPe...
type map (line 50) | typedef map<boost::shared_ptr<ReadGroupProperties const>, AbundanceStatu...
function class (line 58) | class Abundance
function class (line 154) | class TranscriptAbundance : public Abundance
function status (line 182) | void status(AbundanceStatus s) { _status = s; }
function FPKM (line 185) | void FPKM(double fpkm)
function FPKM_conf (line 195) | void FPKM_conf(const ConfidenceInterval& cf) { _FPKM_conf = cf; }
function gamma (line 198) | void gamma(double g) { assert(!isnan(g)); _gamma = g; }
function kappa (line 201) | void kappa(double k) { _kappa = k; }
function num_fragments (line 205) | void num_fragments(double nf)
function num_fragment_var (line 215) | void num_fragment_var(double nfv) { assert (!isnan(nfv)); _num_fragment...
function num_fragment_uncertainty_var (line 220) | void num_fragment_uncertainty_var(double nfv) { assert (!isna...
function num_fragments_by_replicate (line 223) | void num_fragments_by_replicate(CountPerReplicateTable& cpr) { _num_frag...
function FPKM_by_replicate (line 226) | void FPKM_by_replicate(FPKMPerReplicateTable& fpr) { _fpkm_per_replicate...
function status_by_replicate (line 229) | void status_by_replicate(StatusPerReplicateTable& fpr) { _status_per_rep...
function mass_variance (line 232) | void mass_variance(double mv) { _sample_mass_variance = mv; }
function transfrag (line 234) | void transfrag(boost::shared_ptr<Scaffold> tf) { _transfrag = tf; }
function effective_length (line 238) | void effective_length(double el) { _eff_len = el; }
function vector (line 240) | const vector<double>* cond_probs() const { return _cond_probs; }
function cond_probs (line 241) | void cond_probs(vector<double>* cp)
function fpkm_samples (line 248) | void fpkm_samples(const vector<double>& s) { _fpkm_samples = s; }
function virtual (line 311) | virtual void description(const string& d) { _description = d; }
function virtual (line 314) | virtual void locus_tag(const string& L) { _locus_tag = L; }
function virtual (line 317) | virtual void reference_tag(const string& r) { _ref_tag = r; }
function class (line 379) | class AbundanceGroup : public Abundance
type SampleAbundances (line 688) | struct SampleAbundances
FILE: src/assemble.cpp
function weight_of_merge (line 65) | long long weight_of_merge(Scaffold& lhs,
function create_reachability_bp_graph (line 115) | void create_reachability_bp_graph(DAG& dag,
function add_weights_to_reachability_bp_graph (line 201) | void add_weights_to_reachability_bp_graph(ReachGraph& bp,
function holdout_transitivity_hazards (line 293) | void holdout_transitivity_hazards(vector<Scaffold>& hits,
function make_scaffolds (line 371) | bool make_scaffolds(int bundle_left,
FILE: src/biascorrection.cpp
function output_vector (line 21) | void output_vector(vector<double>& v, char* fname)
function colSums (line 34) | double colSums(const ublas::matrix<long double>& A, vector<long double>&...
function fourSums (line 47) | double fourSums(const ublas::matrix<long double>& A, ublas::matrix<long ...
function ones (line 61) | void ones(ublas::matrix<long double>& A)
function get_compatibility_list (line 68) | void get_compatibility_list(const vector<boost::shared_ptr<Scaffold> >& ...
function learn_bias (line 97) | void learn_bias(BundleFactory& bundle_factory, BiasLearner& bl, bool pro...
function BOOST_FOREACH (line 215) | BOOST_FOREACH (const MateHit* hit_p, transcript.mate_hits())
FILE: src/biascorrection.h
function class (line 33) | class BiasLearner{
function class (line 81) | class BiasCorrectionHelper{
FILE: src/bundles.cpp
type ScaffoldSorter (line 49) | struct ScaffoldSorter
method ScaffoldSorter (line 51) | ScaffoldSorter(RefSequenceTable& _rt) : rt(_rt) {}
function load_ref_rnas (line 78) | void load_ref_rnas(FILE* ref_mRNA_file,
type HitlessScaffold (line 273) | struct HitlessScaffold
function unmapped_hit (line 281) | bool unmapped_hit(const MateHit& x)
function BOOST_FOREACH (line 595) | BOOST_FOREACH (MateHit& hit, _hits)
function print_sort_error (line 646) | void print_sort_error(const char* last_chr_name,
type IntronSpanCounter (line 1175) | struct IntronSpanCounter
method IntronSpanCounter (line 1177) | IntronSpanCounter() : left_reads(0), little_reads(0), total_reads(0), ...
function count_introns_in_read (line 1188) | void count_introns_in_read(const ReadHit& read,
function minor_introns (line 1273) | void minor_introns(int bundle_length,
function multimapping_introns (line 1345) | void multimapping_introns(int bundle_length,
function identify_bad_splices (line 1385) | void identify_bad_splices(const HitBundle& bundle,
function inspect_map (line 1623) | void inspect_map(boost::shared_ptr<BundleFactory> bundle_factory,
FILE: src/bundles.h
type BundleStats (line 32) | struct BundleStats
function add_raw_mass (line 110) | void add_raw_mass(double rm) { _raw_mass += rm; }
function rem_raw_mass (line 111) | void rem_raw_mass(double rm) { _raw_mass -= rm; }
function raw_mass (line 112) | double raw_mass() { return _raw_mass; }
function compatible_mass (line 119) | void compatible_mass(double c) { _compatible_mass = c; }
function clear_hits (line 121) | void clear_hits()
function id (line 145) | void id(int i) { _id = i; }
function add_ref_scaffold (line 147) | void add_ref_scaffold(boost::shared_ptr<Scaffold> scaff)
function mass (line 178) | double mass() const
type identity_hash (line 208) | struct identity_hash {
type boost (line 212) | typedef boost::unordered_multimap<uint64_t, MateHit, identity_hash> Open...
function class (line 228) | class BundleFactory
function virtual (line 240) | virtual ~BundleFactory() {}
function bundles_remain (line 243) | bool bundles_remain()
function num_bundles (line 261) | void num_bundles(int n) { _num_bundles = n; }
function virtual (line 263) | virtual void reset()
function bad_intron_table (line 336) | void bad_intron_table(const BadIntronTable& bad_introns)
function read_group_properties (line 344) | void read_group_properties(boost::shared_ptr<ReadGroupProperties> rg)
function class (line 402) | class PrecomputedExpressionBundleFactory : public BundleFactory
function class (line 429) | class IdToLocusMap
FILE: src/clustering.h
type boost (line 40) | typedef boost::adjacency_list <boost::vecS, boost::vecS, boost::undirect...
type ConnectByExonOverlap (line 42) | struct ConnectByExonOverlap
type ConnectByAnnotatedGeneId (line 48) | struct ConnectByAnnotatedGeneId
type ConnectByAnnotatedTssId (line 54) | struct ConnectByAnnotatedTssId
type ConnectByAnnotatedProteinId (line 60) | struct ConnectByAnnotatedProteinId
type ConnectByStrand (line 66) | struct ConnectByStrand
FILE: src/codons.cpp
function packCodon (line 49) | unsigned short packCodon(char n1, char n2, char n3) {
function codonTableInit (line 59) | bool codonTableInit() {
FILE: src/codons.h
function else (line 9) | struct Codon {
function const (line 37) | char operator[](int idx) const {
FILE: src/common.cpp
function gaurd_assembly (line 176) | bool gaurd_assembly()
function asm_verbose (line 181) | void asm_verbose(const char* fmt,...)
function verbose_msg (line 192) | void verbose_msg(const char* fmt,...) {
function parseInt (line 211) | int parseInt(int lower, const char *errmsg, void (*print_usage)()) {
function parseFloat (line 234) | float parseFloat(float lower, float upper, const char *errmsg, void (*pr...
function mkpath (line 261) | int mkpath(const char *s, mode_t mode)
function init_library_table (line 286) | void init_library_table()
function print_library_table (line 348) | void print_library_table()
function init_dispersion_method_table (line 366) | void init_dispersion_method_table()
function print_dispersion_method_table (line 374) | void print_dispersion_method_table()
function init_lib_norm_method_table (line 393) | void init_lib_norm_method_table()
function init_cufflinks_lib_norm_method_table (line 400) | void init_cufflinks_lib_norm_method_table()
function print_lib_norm_method_table (line 408) | void print_lib_norm_method_table()
function init_output_format_table (line 429) | void init_output_format_table()
function print_output_format_table (line 435) | void print_output_format_table()
function encode_seq (line 456) | void encode_seq(const string seqStr, char* seq, char* c_seq)
FILE: src/common.h
type BundleMode (line 204) | enum BundleMode
type BiasMode (line 213) | enum BiasMode
type Strandedness (line 223) | enum Strandedness
type StandardMateOrientation (line 230) | enum StandardMateOrientation
type MateStrandMapping (line 239) | enum MateStrandMapping
type Platform (line 247) | enum Platform
type FLDSource (line 254) | enum FLDSource
type DispersionMethod (line 261) | enum DispersionMethod
type LibNormalizationMethod (line 270) | enum LibNormalizationMethod
type OutputFormat (line 280) | enum OutputFormat
function class (line 288) | class EmpDist
function pdf (line 322) | double pdf(int l) const
function npdf (line 330) | double npdf(int l, int r) const
function cdf (line 341) | void cdf(std::vector<double>& cdf) { _cdf = cdf; }
function cdf (line 342) | double cdf(int l) const
function valid_len (line 351) | bool valid_len(int l) const { return (l >= _min && l <= _max); }
function too_short (line 352) | bool too_short(int l) const { return (l < _min); }
function mode (line 354) | void mode(int mode) { _mode = mode; }
function max (line 357) | void max(int max) { _max = max; }
function min (line 360) | void min(int min) { _min = min; }
function mean (line 363) | void mean(double mean) { _mean = mean; }
function std_dev (line 366) | void std_dev(double std_dev) { _std_dev = std_dev; }
function source (line 370) | void source(FLDSource source) { _source = source; }
function load (line 379) | struct LocusCount
function mate_strand_mapping (line 434) | struct CheckedParameters
function platform (line 542) | void platform(Platform p) { _platform = p; }
function total_map_mass (line 545) | void total_map_mass(long double p) { _total_map_mass = p; }
function normalized_map_mass (line 548) | void normalized_map_mass(long double p) { _norm_map_mass = p; }
function frag_len_dist (line 551) | void frag_len_dist(boost::shared_ptr<EmpDist const> p) { _frag_len_dist...
function bias_learner (line 554) | void bias_learner(boost::shared_ptr<BiasLearner const> bl) { _bias_lear...
function internal_scale_factor (line 559) | void internal_scale_factor(double sf) { _internal_scale_factor = sf; }
function external_scale_factor (line 562) | void external_scale_factor(double sf) { _external_scale_factor = sf; }
function complete_fragments (line 565) | void complete_fragments(bool c) { _complete_fragments = c; }
function internally_scale_mass (line 568) | double internally_scale_mass(double unscaled_mass) const
function mass_dispersion_model (line 581) | void mass_dispersion_model(boost::shared_ptr<const MassDispersionModel> nm)
function mle_error_model (line 591) | void mle_error_model(boost::shared_ptr<const MleErrorModel> nm)
function std (line 596) | const std::vector<LocusCount>& common_scale_compatible_counts() { return...
function common_scale_compatible_counts (line 597) | void common_scale_compatible_counts(const std::vector<LocusCount>& count...
function std (line 599) | const std::vector<LocusCount>& common_scale_total_counts() { return _com...
function common_scale_total_counts (line 600) | void common_scale_total_counts(const std::vector<LocusCount>& counts) { ...
function std (line 602) | const std::vector<LocusCount>& raw_compatible_counts() { return _raw_com...
function raw_compatible_counts (line 603) | void raw_compatible_counts(const std::vector<LocusCount>& counts) { _raw...
function std (line 605) | const std::vector<LocusCount>& raw_total_counts() { return _raw_total_co...
function raw_total_counts (line 606) | void raw_total_counts(const std::vector<LocusCount>& counts) { _raw_tota...
function clear_count_tables (line 608) | void clear_count_tables() {
function multi_read_table (line 623) | void multi_read_table(boost::shared_ptr<MultiReadTable> mrt) { _multi_re...
function condition_name (line 629) | void condition_name(const std::string& cd) { _condition_name = cd; }
function file_path (line 632) | void file_path(const std::string& fp) { _file_path = fp; }
function replicate_num (line 635) | void replicate_num(int rn) { _replicate_num = rn; }
function ref_gtf (line 637) | void ref_gtf(const std::string& file_path, const boost::crc_32_type& gtf...
function mask_gtf (line 643) | void mask_gtf(const std::string& file_path, const boost::crc_32_type& gt...
function checked_parameters (line 651) | void checked_parameters(const CheckedParameters& rhs) { _checked_params ...
function collect_checked_parameters (line 654) | void collect_checked_parameters() {
type LibNormStandards (line 767) | struct LibNormStandards
FILE: src/compress_gtf.cpp
type option (line 44) | struct option
function print_usage (line 54) | void print_usage()
function parse_options (line 68) | int parse_options(int argc, char** argv)
function compress_genes (line 114) | void compress_genes(FILE* ftranscripts,
function driver (line 336) | void driver(vector<FILE*> ref_gtf_files, FILE* gtf_out)
function main (line 361) | int main(int argc, char** argv)
FILE: src/cuffcluster.cpp
type option (line 48) | struct option
function print_usage (line 61) | void print_usage()
function parse_options (line 77) | int parse_options(int argc, char** argv)
type ExprRecord (line 137) | struct ExprRecord
method ExprRecord (line 139) | ExprRecord() :
type ClusterStats (line 186) | struct ClusterStats
method ClusterStats (line 188) | ClusterStats(int dim)
type SortByVariance (line 199) | struct SortByVariance
function assign_to_nearest_cluster (line 212) | void assign_to_nearest_cluster(vector<ExprRecord>& expr_records, vector<...
function get_assignments (line 311) | void get_assignments(const vector<ClusterStats>& clusters,
function split_cluster (line 329) | void split_cluster(const vector<ExprRecord>& expr_records,
function kmeans (line 436) | void kmeans(vector<ExprRecord>& expr_records, int num_clusters, int num_...
function driver (line 554) | void driver(FILE* fpkm_file, FILE* spec_out, FILE* row_matrix_out, FILE*...
function main (line 874) | int main(int argc, char** argv)
FILE: src/cuffcompare.cpp
function openfwrite (line 94) | void openfwrite(FILE* &f, GArgs& args, char opt) {
class GSeqTrack (line 107) | class GSeqTrack {
method get_gseqid (line 118) | int get_gseqid() { return gseq_id; }
method GSeqTrack (line 119) | GSeqTrack(int gid=-1):xloci_f(true,true,false),
function cmpGTrackByName (line 172) | int cmpGTrackByName(const pointer p1, const pointer p2) {
function show_usage (line 177) | void show_usage() {
function main (line 183) | int main(int argc, char * const argv[]) {
function show_exons (line 467) | void show_exons(FILE* f, GffObj& m) {
function ichainMatch (line 476) | bool ichainMatch(GffObj* t, GffObj* r, bool& exonMatch, int fuzz=0) {
function exon_match (line 539) | bool exon_match(GXSeg& r, GXSeg& q, uint fuzz=0) {
function compareLoci2R (line 559) | void compareLoci2R(GList<GLocus>& loci, GList<GSuperLocus>& cmpdata,
function GSeqData (line 833) | GSeqData* getQryData(int gid, GList<GSeqData>& qdata) {
function writeLoci (line 868) | void writeLoci(FILE* f, GList<GLocus> & loci) {
function printXQ1 (line 888) | void printXQ1(FILE* f, int qidx, GList<GLocus>& qloci) {
function numXLoci (line 902) | void numXLoci(GList<GXLocus>& xloci, int& last_id) {
class GProtCl (line 911) | class GProtCl {
method GProtCl (line 914) | GProtCl(GXConsensus* c=NULL):protcl(true,false,false) {
method add_Pcons (line 918) | bool add_Pcons(GXConsensus* c) {
method addMerge (line 930) | void addMerge(GProtCl& pcl, GXConsensus* pclnk) {
method aalen (line 938) | int aalen() {
class GTssCl (line 950) | class GTssCl:public GSeg { //experiment cluster of ref loci (isoforms)
method GTssCl (line 955) | GTssCl(GXConsensus* c=NULL):tsscl(true,false,false) {
method addFirst (line 963) | void addFirst(GXConsensus* c) {
method add_Xcons (line 972) | bool add_Xcons(GXConsensus* c) {
method addMerge (line 1015) | void addMerge(GTssCl& cl, GXConsensus* clnk) {
function printConsGTF (line 1068) | void printConsGTF(FILE* fc, GXConsensus* xc, int xlocnum) {
function tssCluster (line 1107) | void tssCluster(GXLocus& xloc)
function protCluster (line 1155) | void protCluster(GXLocus& xloc, GFaSeqGet *faseq) {
function printXLoci (line 1204) | void printXLoci(FILE* f, FILE* fc, int qcount, GList<GXLocus>& xloci, GF...
function writeIntron (line 1244) | void writeIntron(FILE* f, char strand, GFaSeqGet* faseq, GSeg& iseg,
function reportMIntrons (line 1278) | void reportMIntrons(FILE* fm, FILE* fn, FILE* fq, char strand,
function processLoci (line 1303) | void processLoci(GSeqData& seqdata, GSeqData* refdata, int qfidx) {
function collectRLocData (line 1323) | void collectRLocData(GSuperLocus& stats, GLocus& loc) {
function collectRData (line 1338) | void collectRData(GSuperLocus& stats, GList<GLocus>& loci) {
function collectQLocData (line 1344) | void collectQLocData(GSuperLocus& stats, GLocus& loc) {
function collectQData (line 1361) | void collectQData(GSuperLocus& stats, GList<GLocus>& loci) {
function collectQNOvl (line 1369) | void collectQNOvl(GSuperLocus& stats, GList<GLocus>& loci, GList<GLocus>...
function collectQU (line 1378) | void collectQU(GSuperLocus& stats, GList<GLocus>& nloci) {
function printLocus (line 1385) | void printLocus(FILE* f, GLocus& loc, const char* gseqname) {
function collectRNOvl (line 1392) | void collectRNOvl(GSuperLocus& stats, GList<GLocus>& loci) { //, const c...
function collectCmpData (line 1403) | void collectCmpData(GSuperLocus& stats, GList<GSuperLocus>& cmpdata) { /...
function printLociQ (line 1417) | void printLociQ(FILE* f, GList<GLocus>& loci, char c=' ') {
function printLocQ (line 1426) | void printLocQ(FILE *f, GLocus& loc) {
function collectStats (line 1433) | void collectStats(GSuperLocus& stats, GSeqData* seqdata, GSeqData* refda...
function reportStats (line 1473) | void reportStats(FILE* fout, const char* setname, GSuperLocus& stotal,
function loadRefDescr (line 1605) | void loadRefDescr(const char* fname) {
function GSeqTrack (line 1624) | GSeqTrack* findGSeqTrack(int gsid) {
method get_gseqid (line 118) | int get_gseqid() { return gseq_id; }
method GSeqTrack (line 119) | GSeqTrack(int gid=-1):xloci_f(true,true,false),
function GffObj (line 1633) | GffObj* findRefMatch(GffObj& m, GLocus& rloc, int& ovlen) {
function addXCons (line 1668) | void addXCons(GXLocus* xloc, GffObj* ref, char ovlcode, GffObj* tcons, C...
function getOvlCode (line 1678) | char getOvlCode(GffObj& m, GffObj& r, int& ovlen) {
function getRefOvl (line 1772) | char getRefOvl(GffObj& m, GLocus& rloc, GffObj*& rovl, int& ovlen) {
function findTMatches (line 1802) | void findTMatches(GTrackLocus& loctrack, int qcount) {
function cmpTData_qset (line 1832) | int cmpTData_qset(const pointer* p1, const pointer* p2) {
function printITrack (line 1838) | void printITrack(FILE* ft, GList<GffObj>& mrnas, int qcount, int& cnum) {
function findTRMatch (line 1979) | void findTRMatch(GTrackLocus& loctrack, int qcount, GLocus& rloc) {
function inPolyRun (line 2040) | bool inPolyRun(char strand, GffObj& m, GList<GLocus>* rloci, int& rlocid...
function CTData (line 2071) | CTData* getBestOvl(GffObj& m) {
function reclass_XStrand (line 2079) | void reclass_XStrand(GList<GffObj>& mrnas, GList<GLocus>* rloci) {
function reclass_mRNAs (line 2159) | void reclass_mRNAs(char strand, GList<GffObj>& mrnas, GList<GLocus>* rlo...
function reclassLoci (line 2187) | void reclassLoci(char strand, GList<GLocus>& qloci, GList<GLocus>* rloci...
function umrnaReclass (line 2196) | void umrnaReclass(int qcount, GSeqTrack& gtrack, FILE** ftr, GFaSeqGet*...
function buildXLoci (line 2240) | void buildXLoci(GTrackLocus& loctrack, int qcount, GSeqTrack& gtrack, ch...
function singleQData (line 2318) | void singleQData(GList<GLocus>& qloci, GList<GTrackLocus>& loctracks) {
function umrnasXStrand (line 2376) | void umrnasXStrand(GList<GXLocus>& xloci, GSeqTrack& gtrack) {
function xclusterLoci (line 2414) | void xclusterLoci(int qcount, char strand, GSeqTrack& gtrack) {
function printRefMap (line 2514) | void printRefMap(FILE** frs, int qcount, GList<GLocus>* rloci) {
function trackGData (line 2563) | void trackGData(int qcount, GList<GSeqTrack>& gtracks, GStr& fbasename, ...
FILE: src/cuffdiff.cpp
type option (line 60) | struct option
function print_usage (line 123) | void print_usage()
function parse_options (line 184) | int parse_options(int argc, char** argv)
function print_tests (line 547) | void print_tests(FILE* fout,
function print_FPKM_tracking (line 607) | void print_FPKM_tracking(FILE* fout,
function print_count_tracking (line 698) | void print_count_tracking(FILE* fout,
function print_read_group_tracking (line 765) | void print_read_group_tracking(FILE* fout,
function print_read_group_info (line 829) | void print_read_group_info(FILE* fout,
function print_run_info (line 848) | void print_run_info(FILE* fout)
function p_value_lt (line 857) | bool p_value_lt(const SampleDifference* lhs, const SampleDifference* rhs)
function fdr_significance (line 863) | int fdr_significance(double fdr,
function extract_sample_diffs (line 906) | void extract_sample_diffs(SampleDiffs& diff_map,
function inspect_map_worker (line 921) | void inspect_map_worker(ReplicatedBundleFactory& fac,
function learn_bias_worker (line 945) | void learn_bias_worker(boost::shared_ptr<BundleFactory> fac)
function quantitate_next_locus (line 959) | bool quantitate_next_locus(const RefSequenceTable& rt,
function parse_contrast_file (line 1031) | void parse_contrast_file(FILE* contrast_file,
function parse_sample_sheet_file (line 1123) | void parse_sample_sheet_file(FILE* sample_sheet_file,
function init_default_contrasts (line 1182) | void init_default_contrasts(const vector<boost::shared_ptr<ReplicatedBun...
function parse_norm_standards_file (line 1203) | void parse_norm_standards_file(FILE* norm_standards_file)
function print_variability_models (line 1245) | void print_variability_models(FILE* var_model_out, const vector<boost::s...
type DispModelAverageContext (line 1283) | struct DispModelAverageContext
function fit_dispersions (line 1294) | void fit_dispersions(vector<boost::shared_ptr<ReplicatedBundleFactory> >...
function driver (line 1554) | void driver(FILE* ref_gtf, FILE* mask_gtf, FILE* contrast_file, FILE* no...
function main (line 2236) | int main(int argc, char** argv)
FILE: src/cuffdiff_to_gct.py
class Usage (line 22) | class Usage(Exception):
method __init__ (line 23) | def __init__(self, msg):
function main (line 27) | def main(argv=None):
FILE: src/cufflinks.cpp
type option (line 38) | struct option
function print_usage (line 105) | void print_usage()
function parse_options (line 172) | int parse_options(int argc, char** argv)
function combine_strand_assemblies (line 509) | void combine_strand_assemblies(vector<Scaffold>& lhs,
function guess_strand (line 653) | void guess_strand(int bundle_origin,
function CuffStrand (line 669) | CuffStrand guess_strand_for_interval(const vector<uint8_t>& strand_guess,
function scaffolds_for_bundle (line 685) | bool scaffolds_for_bundle(const HitBundle& bundle,
function decr_pool_count (line 922) | void decr_pool_count()
function quantitate_transcript_cluster (line 930) | void quantitate_transcript_cluster(AbundanceGroup& transfrag_cluster,
function quantitate_transcript_clusters (line 1114) | void quantitate_transcript_clusters(vector<boost::shared_ptr<Scaffold> >...
function assemble_bundle (line 1167) | void assemble_bundle(const RefSequenceTable& rt,
function assemble_hits (line 1431) | bool assemble_hits(BundleFactory& bundle_factory, boost::shared_ptr<Bias...
function driver (line 1582) | void driver(const string& hit_file_name, FILE* ref_gtf, FILE* mask_gtf)
function main (line 1698) | int main(int argc, char** argv)
FILE: src/cuffnorm.cpp
type option (line 60) | struct option
function print_usage (line 83) | void print_usage()
function parse_options (line 114) | int parse_options(int argc, char** argv)
function inspect_map_worker (line 318) | void inspect_map_worker(ReplicatedBundleFactory& fac,
function quantitate_next_locus (line 344) | bool quantitate_next_locus(const RefSequenceTable& rt,
function parse_sample_sheet_file (line 416) | void parse_sample_sheet_file(FILE* sample_sheet_file,
function parse_norm_standards_file (line 474) | void parse_norm_standards_file(FILE* norm_standards_file)
function print_variability_models (line 516) | void print_variability_models(FILE* var_model_out, const vector<boost::s...
function driver (line 554) | void driver(FILE* ref_gtf, FILE* mask_gtf, FILE* contrast_file, FILE* no...
function open_outfiles_for_writing_cuffdiff_format (line 775) | void open_outfiles_for_writing_cuffdiff_format(Outfiles& outfiles)
function open_outfiles_for_writing_simple_table_format (line 936) | void open_outfiles_for_writing_simple_table_format(Outfiles& outfiles)
function open_outfiles_for_writing (line 1096) | void open_outfiles_for_writing(Outfiles& outfiles)
function main (line 1113) | int main(int argc, char** argv)
FILE: src/cuffquant.cpp
type option (line 56) | struct option
function print_usage (line 85) | void print_usage()
function parse_options (line 126) | int parse_options(int argc, char** argv)
type Outfiles (line 379) | struct Outfiles
function print_FPKM_tracking (line 397) | void print_FPKM_tracking(FILE* fout,
function print_count_tracking (line 488) | void print_count_tracking(FILE* fout,
function print_run_info (line 555) | void print_run_info(FILE* fout)
function decr_pool_count (line 573) | void decr_pool_count()
function inspect_map_worker (line 584) | void inspect_map_worker(ReplicatedBundleFactory& fac,
function learn_bias_worker (line 608) | void learn_bias_worker(boost::shared_ptr<BundleFactory> fac)
type AbundanceRecorder (line 622) | struct AbundanceRecorder
method AbundanceRecorder (line 625) | AbundanceRecorder(AbundanceRecorder& rhs) {}
method AbundanceRecorder (line 628) | AbundanceRecorder(int num_samples,
method clear_tracking_data (line 649) | void clear_tracking_data() { _tracking->clear(); }
method light_ab_group_tracking_table (line 653) | const light_ab_group_tracking_table& get_sample_table() const { return...
function BOOST_FOREACH (line 716) | BOOST_FOREACH (boost::shared_ptr<SampleAbundances> ab, abundances)
function sample_worker (line 834) | void sample_worker(const RefSequenceTable& rt,
function quantitate_next_locus (line 921) | bool quantitate_next_locus(const RefSequenceTable& rt,
function parse_norm_standards_file (line 966) | void parse_norm_standards_file(FILE* norm_standards_file)
function driver (line 1009) | void driver(const std::string& ref_gtf_filename, const std::string& mask...
function main (line 1462) | int main(int argc, char** argv)
FILE: src/differential.cpp
function decr_pool_count (line 36) | void decr_pool_count()
function BOOST_FOREACH (line 102) | BOOST_FOREACH (boost::shared_ptr<SampleAbundances> ab, abundances)
function SampleDifference (line 257) | SampleDifference test_diffexp(const FPKMContext& curr,
function get_metadata (line 462) | boost::shared_ptr<SampleDifferenceMetaData> get_metadata(const string de...
function SampleDifference (line 474) | SampleDifference get_de_tests(const string& description,
function test_js (line 558) | bool test_js(const AbundanceGroup& prev_abundance,
function SampleDifference (line 722) | SampleDifference get_ds_tests(const AbundanceGroup& prev_abundance,
function string (line 821) | string make_ref_tag(const string& ref, char classcode)
function string (line 833) | string bundle_locus_tag(const RefSequenceTable& rt,
type LocusVarianceInfo (line 850) | struct LocusVarianceInfo
function sample_worker (line 882) | void sample_worker(bool non_empty,
function dump_locus_variance_info (line 1007) | void dump_locus_variance_info(const string& filename)
function filter_group_for_js_testing (line 1031) | void filter_group_for_js_testing(vector<vector<AbundanceGroup> >& source...
function clear_samples_from_fpkm_tracking_table (line 1072) | void clear_samples_from_fpkm_tracking_table(const string& locus_desc, FP...
function clear_samples_from_tracking_table (line 1087) | void clear_samples_from_tracking_table(boost::shared_ptr<SampleAbundance...
function test_differential (line 1119) | void test_differential(const string& locus_tag,
function print_checked_params_table (line 1517) | void print_checked_params_table(const vector<boost::shared_ptr<ReadGroup...
function validate_cross_sample_parameters (line 1544) | void validate_cross_sample_parameters(const vector<boost::shared_ptr<Rea...
FILE: src/differential.h
type TestStatus (line 34) | enum TestStatus {
type SampleDifferenceMetaData (line 42) | struct SampleDifferenceMetaData
function class (line 53) | class SampleDifference
type map (line 84) | typedef map<string, SampleDifference > SampleDiffs;
type map (line 85) | typedef map<string, boost::shared_ptr<SampleDifferenceMetaData> > Sample...
type Outfiles (line 87) | struct Outfiles
type Tests (line 124) | struct Tests
type TestLauncher (line 144) | struct TestLauncher
function class (line 200) | class TrackingDataWriter : public TestLauncher
FILE: src/filters.cpp
function filter_introns (line 22) | void filter_introns(int bundle_length,
function background_rate (line 135) | double background_rate(const vector<float> depth_of_coverage,
function pre_mrna_filter (line 160) | void pre_mrna_filter(int bundle_length,
function filter_hits (line 332) | void filter_hits(int bundle_length,
function filter_junk_isoforms (line 575) | void filter_junk_isoforms(vector<boost::shared_ptr<Abundance> >& transcr...
function filter_junk_genes (line 689) | void filter_junk_genes(vector<Gene>& genes)
function clip_by_3_prime_dropoff (line 746) | void clip_by_3_prime_dropoff(vector<Scaffold>& scaffolds)
FILE: src/gdna.cpp
function byte (line 24) | byte gdna2bit(char* &nt, int n) {
function ntComplement (line 42) | char ntComplement(char c) {
function g2bit2base (line 46) | char g2bit2base(byte v2bit) {
function gDnaInit (line 66) | bool gDnaInit() {
FILE: src/genes.cpp
function get_next_isoform_id (line 20) | int get_next_isoform_id()
function get_next_gene_id (line 130) | int get_next_gene_id()
function get_next_skipped_region_id (line 145) | int get_next_skipped_region_id()
FILE: src/genes.h
function class (line 33) | class Isoform
function FPKM (line 80) | void FPKM(double fpkm) { _FPKM = fpkm; }
function effective_length (line 83) | void effective_length(double eff_len) { _eff_len = eff_len; }
function status (line 86) | void status(AbundanceStatus status) { _status = status; }
function fraction (line 89) | void fraction(double f) { _fraction = f; }
function confidence (line 92) | void confidence(ConfidenceInterval c) { _confidence = c; }
function coverage (line 95) | void coverage(double cov) { _coverage = cov; }
function FMI (line 99) | void FMI(double fmi) { _FMI = fmi; }
function gene_id (line 107) | void gene_id(string& gid) { _gene_id = gid; }
function estimated_count (line 114) | void estimated_count(double est) { _estimated_count = est; }
function class (line 131) | class Gene
FILE: src/gff.cpp
function gffnames_ref (line 26) | void gffnames_ref(GffNames* &n) {
function gffnames_unref (line 31) | void gffnames_unref(GffNames* &n) {
function gfo_cmpByLoc (line 45) | int gfo_cmpByLoc(const pointer p1, const pointer p2) {
function GffLine (line 865) | GffLine* GffReader::nextGffLine() {
function GffObj (line 916) | GffObj* GffReader::gfoAdd(GffObj* gfo) {
function GffObj (line 926) | GffObj* GffReader::gfoAdd(GPVec<GffObj>& glst, GffObj* gfo) {
function GffObj (line 936) | GffObj* GffReader::gfoFind(const char* id, GPVec<GffObj>*& glst,
function GffObj (line 981) | GffObj* GffReader::updateParent(GffObj* newgfo, GffObj* parent) {
function GffObj (line 997) | GffObj* GffReader::newGffRec(GffLine* gffline, bool keepAttr, bool noExo...
function GffObj (line 1023) | GffObj* GffReader::updateGffRec(GffObj* prevgfo, GffLine* gffline,
function CNonExon (line 1070) | CNonExon* GffReader::subfPoolCheck(GffLine* gffline, GHash<CNonExon>& pe...
function GffObj (line 1094) | GffObj* GffReader::promoteFeature(CNonExon* subp, char*& subp_name, GHas...
function GffObj (line 1301) | GffObj* GffObj::finalize(GffReader* gfr, bool mergeCloseExons, bool keep...
function decodeHexChars (line 1887) | void decodeHexChars(char* dbuf, const char* s, int maxlen=1023) {
FILE: src/gff.h
type GffExonType (line 53) | enum GffExonType {
function class (line 68) | class GffLine {
function class (line 173) | class GffAttr {
function setValue (line 185) | void setValue(const char* av) {
function operator (line 209) | bool operator==(GffAttr& d){
function operator (line 212) | bool operator>(GffAttr& d){
function operator (line 215) | bool operator<(GffAttr& d){
function class (line 224) | class GffNameInfo {
function d (line 237) | bool operator==(GffNameInfo& d){
function d (line 240) | bool operator<(GffNameInfo& d){
function class (line 245) | class GffNameList:public GList<GffNameInfo> {
function lastNameId (line 263) | int lastNameId() { return idlast; }
function addName (line 270) | int addName(const char* tname) {//returns or create an id for the given ...
function addNewName (line 287) | int addNewName(const char* tname) {
function getId (line 295) | int getId(const char* tname) { //only returns a name id# if found
function removeName (line 300) | int removeName() {
function class (line 306) | class GffNames {
type GffPrintMode (line 327) | enum GffPrintMode {
function class (line 338) | class GffAttrs:public GList<GffAttr> {
function class (line 376) | class GffExon : public GSeg {
function class (line 425) | class GffCDSeg:public GSeg {
function class (line 431) | class GffObj:public GSeg {
function exonOverlap (line 676) | bool exonOverlap(uint s, uint e) {//check if ANY exon overlaps given seg...
function exonOverlap (line 684) | bool exonOverlap(GffObj& m) {//check if ANY exon overlaps given segment
function exonOverlapLen (line 718) | int exonOverlapLen(GffObj& m) {
function exonOverlap (line 744) | bool exonOverlap(GffObj* m) {
function xcoordseg (line 775) | void xcoordseg(uint& segstart, uint &segend) {
function unxcoord (line 789) | void unxcoord() { //revert back to absolute genomic/gff coordinates if x...
function unxcoordseg (line 808) | void unxcoordseg(uint& astart, uint &aend) {
function operator (line 822) | bool operator==(GffObj& d){
function operator (line 825) | bool operator>(GffObj& d){
function operator (line 834) | bool operator<(GffObj& d){
function setGeneName (line 846) | void setGeneName(const char* gname) {
function setGeneID (line 850) | void setGeneID(const char* gene_id) {
function empty (line 884) | bool empty() { return (start==0); }
function class (line 897) | class GSeqStat {
function operator (line 915) | bool operator>(GSeqStat& g) {
function operator (line 918) | bool operator<(GSeqStat& g) {
function operator (line 921) | bool operator==(GSeqStat& g) {
function freeAll (line 948) | void freeAll() {
function freeUnused (line 955) | void freeUnused() {
function class (line 979) | class CNonExon { //utility class used in subfeature promotion
function class (line 998) | class GffReader {
FILE: src/gff_utils.cpp
function printFasta (line 8) | void printFasta(FILE* f, GStr& defline, char* seq, int seqlen) {
function qsearch_gloci (line 25) | int qsearch_gloci(uint x, GList<GffLocus>& loci) {
function qsearch_rnas (line 58) | int qsearch_rnas(uint x, GList<GffObj>& rnas) {
function cmpRedundant (line 91) | int cmpRedundant(GffObj& a, GffObj& b) {
function tMatch (line 102) | bool tMatch(GffObj& a, GffObj& b) {
function unsplContained (line 139) | bool unsplContained(GffObj& ti, GffObj& tj, bool fuzzSpan) {
function GffObj (line 169) | GffObj* redundantTranscripts(GffObj& ti, GffObj& tj, bool matchAllIntro...
function gseqCmpName (line 315) | int gseqCmpName(const pointer p1, const pointer p2) {
function printLocus (line 320) | void printLocus(GffLocus* loc, const char* pre) {
function preserveContainedCDS (line 330) | void preserveContainedCDS(GffObj* t, GffObj* tfrom) {
function exonOverlap2Gene (line 344) | bool exonOverlap2Gene(GffObj* t, GffObj& g) {
function collectLocusData (line 514) | void collectLocusData(GList<GenomicSeqData>& ref_data) {
FILE: src/gff_utils.h
function class (line 10) | class GeneInfo { //for Ensembl GTF conversion
function class (line 94) | class GFastaDb {
function init (line 124) | void init(const char* fpath) {
function class (line 213) | class GTData { //transcript associated data
function class (line 235) | class CGeneSym {
function operator (line 242) | bool operator<(CGeneSym& b) {
function operator (line 246) | bool operator==(CGeneSym& b) { return name==b.name; }
function class (line 253) | class GffLocus:public GSeg {
function class (line 470) | class GenomicSeqData {
function d (line 486) | bool operator==(GenomicSeqData& d){
function d (line 489) | bool operator<(GenomicSeqData& d){
function class (line 496) | class GSpliceSite {
function canonicalDonor (line 538) | bool canonicalDonor() {
function c (line 541) | bool operator==(GSpliceSite& c) {
function else (line 558) | struct GffLoader {
FILE: src/gffread.cpp
class SeqInfo (line 88) | class SeqInfo { //populated from the -s option of gffread
method SeqInfo (line 92) | SeqInfo( int l, char* s) {
class RefTran (line 105) | class RefTran {
method RefTran (line 108) | RefTran(char *ns) {
function loadSeqInfo (line 178) | void loadSeqInfo(FILE* f, GHash<SeqInfo> &si) {
function loadRefTable (line 208) | void loadRefTable(FILE* f, GHash<RefTran>& rt) {
function GFaSeqGet (line 262) | GFaSeqGet* fastaSeqGet(GFastaDb& gfasta, GffObj& gffrec) {
function adjust_stopcodon (line 268) | int adjust_stopcodon(GffObj& gffrec, int adj, GList<GSeg>* seglst=NULL) {
function process_transcript (line 312) | bool process_transcript(GFastaDb& gfasta, GffObj& gffrec) {
function openfw (line 592) | void openfw(FILE* &f, GArgs& args, char opt) {
function printGff3Header (line 607) | void printGff3Header(FILE* f, GArgs& args) {
function validateGffRec (line 616) | bool validateGffRec(GffObj* gffrec, GList<GffObj>* gfnew) {
function main (line 681) | int main(int argc, char * const argv[]) {
FILE: src/graph_optimize.cpp
function fill_gaps (line 30) | void fill_gaps(vector<Scaffold>& scaffolds, int fill_size)
type ConflictState (line 36) | enum ConflictState { UNKNOWN_CONFLICTS = 0, SAME_CONFLICTS, DIFF_CONFLIC...
function scaff_left_lt_right_gt (line 38) | bool scaff_left_lt_right_gt(const Scaffold& lhs, const Scaffold& rhs)
function op_left_lt_right_lt (line 45) | bool op_left_lt_right_lt(const AugmentedCuffOp& lhs, const AugmentedCuff...
function extract_conflicting_ops (line 58) | void extract_conflicting_ops(const vector<AugmentedCuffOp>& ops,
function collect_non_redundant_ops (line 91) | void collect_non_redundant_ops(const vector<Scaffold>& scaffolds,
function fill_unambiguous_unknowns (line 108) | void fill_unambiguous_unknowns(vector<Scaffold>& to_fill,
function add_non_constitutive_to_scaffold_mask (line 140) | void add_non_constitutive_to_scaffold_mask(const vector<Scaffold>& scaff...
function collapse_contained_transfrags (line 212) | bool collapse_contained_transfrags(vector<Scaffold>& scaffolds,
function scaff_smaller_lt_rt (line 294) | bool scaff_smaller_lt_rt(const Scaffold& lhs, const Scaffold& rhs)
type FragIndexSortSmallerLR (line 310) | struct FragIndexSortSmallerLR
method FragIndexSortSmallerLR (line 312) | FragIndexSortSmallerLR(const vector<Scaffold>& frags) : fragments(frag...
function collapse_equivalent_transfrags (line 336) | bool collapse_equivalent_transfrags(vector<Scaffold>& fragments,
function compress_consitutive (line 601) | void compress_consitutive(vector<Scaffold>& hits)
function compress_redundant (line 650) | void compress_redundant(vector<Scaffold>& fragments)
function compress_fragments (line 691) | void compress_fragments(vector<Scaffold>& fragments)
function compress_overlap_dag_paths (line 705) | void compress_overlap_dag_paths(DAG& bundle_dag,
FILE: src/gtf_reads.cpp
type option (line 32) | struct option
function print_usage (line 36) | void print_usage()
function parse_options (line 42) | int parse_options(int argc, char** argv)
function driver (line 61) | void driver(FILE* ref_gtf, FILE* sam_hit_file)
function main (line 127) | int main(int argc, char** argv)
FILE: src/gtf_to_sam.cpp
type option (line 39) | struct option
function print_usage (line 45) | void print_usage()
function parse_options (line 57) | int parse_options(int argc, char** argv)
function print_scaff_as_sam (line 85) | void print_scaff_as_sam(FILE* sam_out,
function set_relative_fpkms (line 184) | void set_relative_fpkms(vector<boost::shared_ptr<Scaffold> >& ref_mRNAs)
function driver (line 252) | void driver(vector<FILE*> ref_gtf_files, FILE* sam_out)
function main (line 282) | int main(int argc, char** argv)
FILE: src/gtf_tracking.cpp
function cmpByPtr (line 21) | int cmpByPtr(const pointer p1, const pointer p2) {
function betterRef (line 25) | bool betterRef(GffObj* a, GffObj* b) {
function GffObj (line 36) | GffObj* is_RefDup(GffObj* m, GList<GffObj>& mrnas, int& dupidx) {
function intronRedundant (line 61) | bool intronRedundant(GffObj& ti, GffObj& tj, bool no5share=false) {
function t_contains (line 140) | bool t_contains(GffObj& a, GffObj& b) {
function is_Redundant (line 158) | int is_Redundant(GffObj*m, GList<GffObj>* mrnas, bool no5share=false) {
function t_dominates (line 178) | bool t_dominates(GffObj* a, GffObj* b) {
function betterDupRef (line 186) | bool betterDupRef(GffObj* a, GffObj* b) {
function parse_mRNAs (line 198) | int parse_mRNAs(GfList& mrnas,
function singleExonTMatch (line 376) | bool singleExonTMatch(GffObj& m, GffObj& r, int& ovlen) {
function tMatch (line 385) | bool tMatch(GffObj& a, GffObj& b, int& ovlen, bool fuzzunspl, bool conta...
function cluster_mRNAs (line 431) | void cluster_mRNAs(GList<GffObj> & mrnas, GList<GLocus> & loci, int qfid...
function fix_umrnas (line 474) | int fix_umrnas(GSeqData& seqdata, GSeqData* rdata, FILE* fdis=NULL) {
function GSeqData (line 581) | GSeqData* getRefData(int gid, GList<GSeqData>& ref_data) {
function read_transcripts (line 590) | void read_transcripts(FILE* f, GList<GSeqData>& seqdata,
function cmpGSeqByName (line 608) | int cmpGSeqByName(const pointer p1, const pointer p2) {
function sort_GSeqs_byName (line 612) | void sort_GSeqs_byName(GList<GSeqData>& seqdata) {
function read_mRNAs (line 616) | void read_mRNAs(FILE* f, GList<GSeqData>& seqdata, GList<GSeqData>* ref_...
function qsearch_mrnas (line 712) | int qsearch_mrnas(uint x, GList<GffObj>& mrnas) {
function qsearch_loci (line 745) | int qsearch_loci(uint x, GList<GLocus>& loci) {
FILE: src/gtf_tracking.h
function class (line 33) | class GFastaHandler {
function init (line 58) | void init(const char* fpath) {
function class (line 149) | class COvLink {
function operator (line 178) | bool operator<(COvLink& b) {
function operator (line 183) | bool operator==(COvLink& b) {
function class (line 188) | class GISeg: public GSeg {
function class (line 194) | class GIArray:public GArray<GISeg> {
function class (line 216) | class CEqList: public GList<GffObj> {
function class (line 224) | class CTData { //transcript associated data
function joinEqList (line 270) | void joinEqList(GffObj* m) { //add list from m
function getBestCode (line 348) | char getBestCode() {
function operator (line 351) | bool operator<(CTData& b) { return (mrna < b.mrna); }
function operator (line 352) | bool operator==(CTData& b) { return (mrna==b.mrna); }
function class (line 359) | class GXSeg : public GSeg {
function class (line 862) | class GSeqData {
function operator (line 894) | bool operator==(GSeqData& d){
function operator (line 897) | bool operator>(GSeqData& d){
function operator (line 900) | bool operator<(GSeqData& d){
function class (line 907) | class GQCluster : public GList<GffObj> {
function class (line 1076) | class GXConsensus:public GSeg {
function class (line 1112) | class GXLocus:public GSeg {
FILE: src/hits.cpp
function hit_insert_id_lt (line 167) | bool hit_insert_id_lt(const ReadHit& h1, const ReadHit& h2)
function hits_eq_mod_id (line 172) | bool hits_eq_mod_id(const ReadHit& lhs, const ReadHit& rhs)
function hits_eq_non_multi (line 182) | bool hits_eq_non_multi(const MateHit& lhs, const MateHit& rhs)
function hits_eq_non_multi_non_replicate (line 191) | bool hits_eq_non_multi_non_replicate(const MateHit& lhs, const MateHit& ...
function hits_equals (line 199) | bool hits_equals(const MateHit& lhs, const MateHit& rhs)
function has_no_collapse_mass (line 221) | bool has_no_collapse_mass(const MateHit& hit)
function collapse_hits (line 228) | void collapse_hits(const vector<MateHit>& hits,
function mate_hit_lt (line 265) | bool mate_hit_lt(const MateHit& lhs, const MateHit& rhs)
function ReadHit (line 327) | ReadHit HitFactory::create_hit(const string& insert_name,
function ReadHit (line 356) | ReadHit HitFactory::create_hit(const string& insert_name,
function CuffStrand (line 385) | CuffStrand use_stranded_protocol(uint32_t sam_flag, MateStrandMapping msm)
function Platform (line 604) | Platform str_to_platform(const string pl_str)
function BOOST_FOREACH (line 1040) | BOOST_FOREACH(const LocusCount& c, rg_props.raw_compatible_counts())
function BOOST_FOREACH (line 1047) | BOOST_FOREACH(const LocusCount& c, rg_props.raw_total_counts())
function HitFactory (line 1210) | HitFactory* createSamHitFactory(const string& hit_file_name, ReadTable& ...
function HitFactory (line 1278) | HitFactory* createSamHitFactory(const string& hit_file_name, ReadTable& ...
FILE: src/hits.h
type CuffStrand (line 45) | enum CuffStrand { CUFF_STRAND_UNKNOWN = 0, CUFF_FWD = 1, CUFF_REV = 2, C...
type CigarOpCode (line 48) | enum CigarOpCode
type CigarOp (line 59) | struct CigarOp
type InsertID (line 69) | typedef uint64_t InsertID;
type RefID (line 70) | typedef uint64_t RefID;
type ReadHit (line 77) | struct ReadHit
function read_len (line 167) | int read_len() const
function operator (line 205) | bool operator==(const ReadHit& rhs) const
function gaps (line 241) | void gaps(vector<pair<int,int> >& gaps_out) const
function class (line 334) | class ReadTable
function class (line 380) | class RefSequenceTable
function RefID (line 418) | RefID get_id(const string& name,
function Sequence (line 460) | Sequence* get_seq(RefID ID) const
function SequenceInfo (line 469) | const SequenceInfo* get_info(RefID ID) const
function observation_order (line 481) | int observation_order(RefID ID) const
function order_recs_lexicographically (line 492) | void order_recs_lexicographically()
function print_rec_ordering (line 510) | void print_rec_ordering()
function iterator (line 518) | iterator begin() { return _by_id.begin(); }
function iterator (line 519) | iterator end() { return _by_id.end(); }
function clear (line 526) | void clear()
function class (line 562) | class HitFactory
function class (line 674) | class SAMHitFactory : public HitFactory
function class (line 726) | class BAMHitFactory : public HitFactory
function class (line 753) | class SamtoolsHitFactory : public BAMHitFactory
function class (line 819) | class HTSHitFactory : public BAMHitFactory
function class (line 900) | class PrecomputedExpressionHitFactory : public HitFactory
function class (line 1030) | class MateHit
function ReadHit (line 1062) | const ReadHit* left_alignment() const {return _left_alignment;}
function left_alignment (line 1063) | void left_alignment(const ReadHit* left_alignment)
function ReadHit (line 1068) | const ReadHit* right_alignment() const {return _right_alignment;}
function right_alignment (line 1069) | void right_alignment(const ReadHit* right_alignment)
function is_mapped (line 1075) | void is_mapped(bool mapped)
function num_hits (line 1080) | int num_hits() const
function CuffStrand (line 1122) | CuffStrand strand() const
function mass (line 1196) | double mass() const
function edit_dist (line 1219) | unsigned int edit_dist() const
function collapse_mass (line 1230) | void collapse_mass(double m) { _collapse_mass = m; }
function incr_collapse_mass (line 1231) | void incr_collapse_mass(double incr) { _collapse_mass += incr; }
FILE: src/jensen_shannon.cpp
function entropy (line 18) | double entropy(const Eigen::VectorXd& p)
function jensen_shannon_distance (line 34) | double jensen_shannon_distance(std::vector<Eigen::VectorXd>& sample_kappas)
function jensen_shannon_gradient (line 70) | void jensen_shannon_gradient(vector<Eigen::VectorXd>& sample_kappas,
function make_js_covariance_matrix (line 142) | void make_js_covariance_matrix(vector<ublas::matrix<double> >& kappa_cov...
FILE: src/lemon/bfs.h
type GR (line 45) | typedef GR Graph;
type typename (line 53) | typedef typename Graph::template
function PredMap (line 59) | static PredMap *createPredMap(const GR &G)
type NullMap (line 68) | typedef NullMap<typename
function ProcessedMap (line 77) | static ProcessedMap *createProcessedMap(const GR &)
type typename (line 87) | typedef typename Graph::template
function ReachedMap (line 93) | static ReachedMap *createReachedMap(const GR &G)
type typename (line 102) | typedef typename Graph::template
function DistMap (line 107) | static DistMap *createDistMap(const GR &G)
type TR (line 151) | typedef TR Traits;
type typename (line 153) | typedef typename TR::Graph Graph;
type typename (line 157) | typedef typename TR::PredMap PredMap;
type typename (line 159) | typedef typename TR::ReachedMap ReachedMap;
type typename (line 161) | typedef typename TR::ProcessedMap ProcessedMap;
type typename (line 163) | typedef typename TR::DistMap DistMap;
type typename (line 167) | typedef typename Graph::NodeIt NodeIt;
type typename (line 168) | typedef typename Graph::Edge Edge;
type typename (line 169) | typedef typename Graph::OutEdgeIt OutEdgeIt;
function create_maps (line 197) | void create_maps()
type T (line 231) | typedef T PredMap;
function PredMap (line 232) | static PredMap *createPredMap(const Graph &)
type T (line 249) | typedef T DistMap;
function DistMap (line 250) | static DistMap *createDistMap(const Graph &)
type T (line 267) | typedef T ReachedMap;
function ReachedMap (line 268) | static ReachedMap *createReachedMap(const Graph &)
type T (line 285) | typedef T ProcessedMap;
function ProcessedMap (line 286) | static ProcessedMap *createProcessedMap(const Graph &)
function Traits (line 301) | struct DefGraphProcessedMapTraits : public Traits {
function addSource (line 447) | void addSource(Node s)
function Node (line 466) | Node processNextNode()
function Node (line 497) | Node processNextNode(Node target, bool& reach)
function Node (line 556) | Node nextNode()
function emptyQueue (line 566) | bool emptyQueue() { return _queue_tail==_queue_head; }
function queueSize (line 570) | int queueSize() { return _queue_head-_queue_tail; }
function start (line 585) | void start()
function start (line 602) | void start(Node dest)
function run (line 646) | void run(Node s) {
function run (line 665) | int run(Node s,Node t) {
type PredMapPath (line 682) | typedef PredMapPath<Graph, PredMap> Path;
function Path (line 688) | Path path(Node t)
function dist (line 699) | int dist(Node v) const { return (*_dist)[v]; }
function Edge (line 712) | Edge predEdge(Node v) const { return (*_pred)[v];}
function Node (line 726) | Node predNode(Node v) const { return (*_pred)[v]==INVALID ? INVALID:
function reached (line 751) | bool reached(Node v) { return (*_reached)[v]; }
type GR (line 764) | typedef GR Graph;
type NullMap (line 772) | typedef NullMap<typename
function PredMap (line 781) | static PredMap *createPredMap(const GR &)
type NullMap (line 792) | typedef NullMap<typename
function ProcessedMap (line 801) | static ProcessedMap *createProcessedMap(const GR &)
type typename (line 811) | typedef typename Graph::template
function ReachedMap (line 817) | static ReachedMap *createReachedMap(const GR &G)
type NullMap (line 826) | typedef NullMap<typename
function DistMap (line 834) | static DistMap *createDistMap(const GR &)
type BfsWizardDefaultTraits (line 853) | typedef BfsWizardDefaultTraits<GR> Base;
type TR (line 914) | typedef TR Base;
type typename (line 917) | typedef typename TR::Graph Graph;
type typename (line 919) | typedef typename Graph::Node Node;
type typename (line 921) | typedef typename Graph::NodeIt NodeIt;
type typename (line 923) | typedef typename Graph::Edge Edge;
type typename (line 925) | typedef typename Graph::OutEdgeIt OutEdgeIt;
type typename (line 929) | typedef typename TR::ReachedMap ReachedMap;
type typename (line 932) | typedef typename TR::ProcessedMap ProcessedMap;
type typename (line 935) | typedef typename TR::PredMap PredMap;
type typename (line 937) | typedef typename TR::DistMap DistMap;
function TR (line 951) | BfsWizard(const TR &b) : TR(b) {}
function run (line 959) | void run()
function run (line 978) | void run(Node s)
type T (line 986) | typedef T PredMap;
function PredMap (line 987) | static PredMap *createPredMap(const Graph &) { return 0; }
function TR (line 988) | DefPredMapBase(const TR &b) : TR(b) {}
type T (line 1007) | typedef T ReachedMap;
function ReachedMap (line 1008) | static ReachedMap *createReachedMap(const Graph &) { return 0; }
function TR (line 1009) | DefReachedMapBase(const TR &b) : TR(b) {}
type T (line 1028) | typedef T ProcessedMap;
function ProcessedMap (line 1029) | static ProcessedMap *createProcessedMap(const Graph &) { return 0; }
function TR (line 1030) | DefProcessedMapBase(const TR &b) : TR(b) {}
type T (line 1049) | typedef T DistMap;
function DistMap (line 1050) | static DistMap *createDistMap(const Graph &) { return 0; }
function TR (line 1051) | DefDistMapBase(const TR &b) : TR(b) {}
type _Graph (line 1110) | typedef _Graph Graph;
type typename (line 1111) | typedef typename Graph::Edge Edge;
type typename (line 1112) | typedef typename Graph::Node Node;
function discover (line 1117) | void discover(const Edge& edge) {}
function reach (line 1121) | void reach(const Node& node) {}
function examine (line 1127) | void examine(const Edge& edge) {}
function start (line 1131) | void start(const Node& node) {}
function process (line 1135) | void process(const Node& node) {}
type _Graph (line 1140) | typedef _Graph Graph;
type typename (line 1141) | typedef typename Graph::Edge Edge;
type typename (line 1142) | typedef typename Graph::Node Node;
function discover (line 1143) | void discover(const Edge&) {}
function reach (line 1144) | void reach(const Node&) {}
function examine (line 1145) | void examine(const Edge&) {}
function start (line 1146) | void start(const Node&) {}
function process (line 1147) | void process(const Node&) {}
function constraints (line 1151) | void constraints() {
type _Graph (line 1173) | typedef _Graph Graph;
type typename (line 1180) | typedef typename Graph::template
function ReachedMap (line 1187) | static ReachedMap *createReachedMap(const Graph &graph) {
function class (line 1232) | class UninitializedParameter : public lemon::UninitializedParameter {
type _Traits (line 1240) | typedef _Traits Traits;
type typename (line 1242) | typedef typename Traits::Graph Graph;
type _Visitor (line 1244) | typedef _Visitor Visitor;
type typename (line 1247) | typedef typename Traits::ReachedMap ReachedMap;
type typename (line 1252) | typedef typename Graph::NodeIt NodeIt;
type typename (line 1253) | typedef typename Graph::Edge Edge;
type typename (line 1254) | typedef typename Graph::OutEdgeIt OutEdgeIt;
function create_maps (line 1271) | void create_maps() {
type T (line 1291) | typedef T ReachedMap;
function ReachedMap (line 1292) | static ReachedMap *createReachedMap(const Graph &graph) {
function addSource (line 1371) | void addSource(Node s) {
function Node (line 1387) | Node processNextNode() {
function Node (line 1417) | Node processNextNode(Node target, bool& reach) {
function Node (line 1474) | Node nextNode() {
function emptyQueue (line 1483) | bool emptyQueue() { return _list_front == _list_back; }
function queueSize (line 1488) | int queueSize() { return _list_back - _list_front; }
function start (line 1496) | void start() {
function start (line 1506) | void start(Node dest) {
function run (line 1542) | void run(Node s) {
function run (line 1565) | void run() {
function reached (line 1590) | bool reached(Node v) { return (*_reached)[v]; }
FILE: src/lemon/bin_heap.h
function namespace (line 30) | namespace lemon {
FILE: src/lemon/bipartite_matching.h
function namespace (line 37) | namespace lemon {
type typename (line 586) | typedef typename _WeightMap::Value Value;
type _BpUGraph (line 589) | typedef _BpUGraph BpUGraph;
type _WeightMap (line 592) | typedef _WeightMap WeightMap;
type typename (line 598) | typedef typename BpUGraph::template ANodeMap<int> HeapCrossRef;
function HeapCrossRef (line 605) | static HeapCrossRef *createHeapCrossRef(const BpUGraph &graph) {
type FibHeap (line 617) | typedef FibHeap<Value, HeapCrossRef> Heap;
function Heap (line 623) | static Heap *createHeap(HeapCrossRef& crossref) {
type typename (line 658) | typedef typename Traits::BpUGraph BpUGraph;
type typename (line 659) | typedef typename Traits::WeightMap WeightMap;
type typename (line 660) | typedef typename Traits::Value Value;
type typename (line 665) | typedef typename Traits::Heap Heap;
type typename (line 668) | typedef typename BpUGraph::Node Node;
type typename (line 669) | typedef typename BpUGraph::ANodeIt ANodeIt;
type typename (line 670) | typedef typename BpUGraph::BNodeIt BNodeIt;
type typename (line 671) | typedef typename BpUGraph::UEdge UEdge;
type typename (line 672) | typedef typename BpUGraph::UEdgeIt UEdgeIt;
type typename (line 673) | typedef typename BpUGraph::IncEdgeIt IncEdgeIt;
type typename (line 675) | typedef typename BpUGraph::template ANodeMap<UEdge> ANodeMatchingMap;
type typename (line 676) | typedef typename BpUGraph::template BNodeMap<UEdge> BNodeMatchingMap;
type typename (line 678) | typedef typename BpUGraph::template ANodeMap<Value> ANodePotentialMap;
type typename (line 679) | typedef typename BpUGraph::template BNodeMap<Value> BNodePotentialMap;
type CR (line 701) | typedef CR HeapCrossRef;
type H (line 702) | typedef H Heap;
function HeapCrossRef (line 703) | static HeapCrossRef *createHeapCrossRef(const BpUGraph &) {
function Heap (line 706) | static Heap *createHeap(HeapCrossRef &) {
type DefHeap (line 717) | struct DefHeap
type CR (line 726) | typedef CR HeapCrossRef;
type H (line 727) | typedef H Heap;
function HeapCrossRef (line 728) | static HeapCrossRef *createHeapCrossRef(const BpUGraph &graph) {
function Heap (line 731) | static Heap *createHeap(HeapCrossRef &crossref) {
type DefStandardHeap (line 744) | struct DefStandardHeap
function init (line 808) | void init() {
function matchingEdge (line 1052) | bool matchingEdge(const UEdge& edge) const {
function UEdge (line 1060) | UEdge matchingEdge(const Node& node) const {
function destroyStructures (line 1097) | void destroyStructures() {
type typename (line 1187) | typedef typename _CostMap::Value Value;
type _BpUGraph (line 1190) | typedef _BpUGraph BpUGraph;
type _CostMap (line 1193) | typedef _CostMap CostMap;
type typename (line 1199) | typedef typename BpUGraph::template NodeMap<int> HeapCrossRef;
function HeapCrossRef (line 1206) | static HeapCrossRef *createHeapCrossRef(const BpUGraph &graph) {
type FibHeap (line 1218) | typedef FibHeap<Value, HeapCrossRef> Heap;
function Heap (line 1224) | static Heap *createHeap(HeapCrossRef& crossref) {
type typename (line 1257) | typedef typename Traits::BpUGraph BpUGraph;
type typename (line 1258) | typedef typename Traits::CostMap CostMap;
type typename (line 1259) | typedef typename Traits::Value Value;
type typename (line 1264) | typedef typename Traits::Heap Heap;
type typename (line 1267) | typedef typename BpUGraph::Node Node;
type typename (line 1268) | typedef typename BpUGraph::ANodeIt ANodeIt;
type typename (line 1269) | typedef typename BpUGraph::BNodeIt BNodeIt;
type typename (line 1270) | typedef typename BpUGraph::UEdge UEdge;
type typename (line 1271) | typedef typename BpUGraph::UEdgeIt UEdgeIt;
type typename (line 1272) | typedef typename BpUGraph::IncEdgeIt IncEdgeIt;
type typename (line 1274) | typedef typename BpUGraph::template ANodeMap<UEdge> ANodeMatchingMap;
type typename (line 1275) | typedef typename BpUGraph::template BNodeMap<UEdge> BNodeMatchingMap;
type typename (line 1277) | typedef typename BpUGraph::template ANodeMap<Value> ANodePotentialMap;
type typename (line 1278) | typedef typename BpUGraph::template BNodeMap<Value> BNodePotentialMap;
type CR (line 1300) | typedef CR HeapCrossRef;
type H (line 1301) | typedef H Heap;
function HeapCrossRef (line 1302) | static HeapCrossRef *createHeapCrossRef(const BpUGraph &) {
function Heap (line 1305) | static Heap *createHeap(HeapCrossRef &) {
type DefHeap (line 1316) | struct DefHeap
type CR (line 1325) | typedef CR HeapCrossRef;
type H (line 1326) | typedef H Heap;
function HeapCrossRef (line 1327) | static HeapCrossRef *createHeapCrossRef(const BpUGraph &graph) {
function Heap (line 1330) | static Heap *createHeap(HeapCrossRef &crossref) {
type DefStandardHeap (line 1343) | struct DefStandardHeap
function init (line 1407) | void init() {
function augment (line 1432) | bool augment() {
function start (line 1538) | void start() {
function run (line 1545) | void run() {
function matchingEdge (line 1632) | bool matchingEdge(const UEdge& edge) const {
function UEdge (line 1640) | UEdge matchingEdge(const Node& node) const {
function destroyStructures (line 1677) | void destroyStructures() {
FILE: src/lemon/bits/alteration_notifier.h
function namespace (line 31) | namespace lemon {
function erase (line 429) | void erase(const std::vector<Item>& items) {
function build (line 448) | void build() {
function clear (line 468) | void clear() {
FILE: src/lemon/bits/array_map.h
function namespace (line 33) | namespace lemon {
FILE: src/lemon/bits/base_extender.h
function namespace (line 34) | namespace lemon {
function first (line 350) | void first(BNode& node) const {
function next (line 353) | void next(BNode& node) const {
function id (line 357) | int id(const BNode& node) const {
function Node (line 361) | Node source(const UEdge& edge) const {
function Node (line 364) | Node target(const UEdge& edge) const {
function firstInc (line 368) | void firstInc(UEdge& edge, bool& dir, const Node& node) const {
function nextInc (line 377) | void nextInc(UEdge& edge, bool& dir) const {
function class (line 386) | class Edge : public UEdge {
function first (line 409) | void first(Edge& edge) const {
function next (line 414) | void next(Edge& edge) const {
function firstOut (line 421) | void firstOut(Edge& edge, const Node& node) const {
function nextOut (line 430) | void nextOut(Edge& edge) const {
function firstIn (line 439) | void firstIn(Edge& edge, const Node& node) const {
function nextIn (line 448) | void nextIn(Edge& edge) const {
function Node (line 457) | Node source(const Edge& edge) const {
function Node (line 460) | Node target(const Edge& edge) const {
function id (line 464) | int id(const Edge& edge) const {
function Edge (line 468) | Edge edgeFromId(int ix) const {
function direction (line 475) | bool direction(const Edge& edge) const {
function Edge (line 479) | Edge direct(const UEdge& edge, bool dir) const {
FILE: src/lemon/bits/debug_map.h
function namespace (line 38) | namespace lemon {
type _Graph (line 84) | typedef _Graph Graph;
type _Item (line 86) | typedef _Item Item;
type True (line 88) | typedef True ReferenceMapTag;
type _Item (line 91) | typedef _Item Key;
type _Value (line 93) | typedef _Value Value;
type typename (line 96) | typedef typename ItemSetTraits<_Graph, _Item>::ItemNotifier Notifier;
type DebugMap (line 99) | typedef DebugMap Map;
type typename (line 101) | typedef typename Notifier::ObserverBase Parent;
type typename (line 104) | typedef typename Container::reference Reference;
type typename (line 106) | typedef typename Container::const_reference ConstReference;
function Parent (line 142) | DebugMap(const DebugMap& _copy) : Parent() {
function ConstReference (line 217) | ConstReference operator[](const Key& key) const {
function set (line 226) | void set(const Key& key, const Value& value) {
function virtual (line 260) | virtual void add(const std::vector<Key>& keys) {
function virtual (line 290) | virtual void erase(const Key& key) {
function virtual (line 310) | virtual void erase(const std::vector<Key>& keys) {
function virtual (line 332) | virtual void build() {
function virtual (line 356) | virtual void clear() {
FILE: src/lemon/bits/default_map.h
function namespace (line 31) | namespace lemon {
FILE: src/lemon/bits/graph_adaptor_extender.h
function namespace (line 31) | namespace lemon {
function Node (line 170) | Node baseNode(const OutEdgeIt &e) const {
function Node (line 177) | Node runningNode(const OutEdgeIt &e) const {
function Node (line 184) | Node baseNode(const InEdgeIt &e) const {
function Node (line 191) | Node runningNode(const InEdgeIt &e) const {
type _UGraph (line 206) | typedef _UGraph UGraph;
type UGraphAdaptorExtender (line 207) | typedef UGraphAdaptorExtender Adaptor;
type typename (line 209) | typedef typename Parent::Node Node;
type typename (line 210) | typedef typename Parent::Edge Edge;
type typename (line 211) | typedef typename Parent::UEdge UEdge;
function maxId (line 215) | int maxId(Node) const {
function maxId (line 219) | int maxId(Edge) const {
function maxId (line 223) | int maxId(UEdge) const {
function Node (line 227) | Node fromId(int id, Node) const {
function Edge (line 231) | Edge fromId(int id, Edge) const {
function UEdge (line 235) | UEdge fromId(int id, UEdge) const {
function Node (line 239) | Node oppositeNode(const Node &n, const UEdge &e) const {
function Edge (line 248) | Edge oppositeEdge(const Edge &e) const {
function Edge (line 253) | Edge direct(const UEdge &ue, const Node &s) const {
function class (line 258) | class NodeIt : public Node {
function class (line 281) | class EdgeIt : public Edge {
function class (line 304) | class OutEdgeIt : public Edge {
function class (line 328) | class InEdgeIt : public Edge {
function class (line 351) | class UEdgeIt : public Parent::UEdge {
function class (line 373) | class IncEdgeIt : public Parent::UEdge {
function Node (line 401) | Node baseNode(const OutEdgeIt &e) const {
function Node (line 408) | Node runningNode(const OutEdgeIt &e) const {
function Node (line 415) | Node baseNode(const InEdgeIt &e) const {
function Node (line 422) | Node runningNode(const InEdgeIt &e) const {
function Node (line 429) | Node baseNode(const IncEdgeIt &e) const {
function Node (line 435) | Node runningNode(const IncEdgeIt &e) const {
type BpUGraphAdaptorExtender (line 448) | typedef BpUGraphAdaptorExtender Graph;
type typename (line 450) | typedef typename Parent::Node Node;
type typename (line 451) | typedef typename Parent::BNode BNode;
type typename (line 452) | typedef typename Parent::ANode ANode;
type typename (line 453) | typedef typename Parent::Edge Edge;
type typename (line 454) | typedef typename Parent::UEdge UEdge;
function maxId (line 457) | int maxId(Node) const {
function maxId (line 460) | int maxId(BNode) const {
function maxId (line 463) | int maxId(ANode) const {
function maxId (line 466) | int maxId(Edge) const {
function maxId (line 469) | int maxId(UEdge) const {
function Node (line 474) | Node fromId(int id, Node) const {
function ANode (line 477) | ANode fromId(int id, ANode) const {
function BNode (line 480) | BNode fromId(int id, BNode) const {
function Edge (line 483) | Edge fromId(int id, Edge) const {
function UEdge (line 486) | UEdge fromId(int id, UEdge) const {
function class (line 490) | class NodeIt : public Node {
function class (line 512) | class ANodeIt : public Node {
function class (line 534) | class BNodeIt : public Node {
function class (line 556) | class EdgeIt : public Edge {
function class (line 579) | class UEdgeIt : public UEdge {
function class (line 601) | class OutEdgeIt : public Edge {
function class (line 626) | class InEdgeIt : public Edge {
function Node (line 653) | Node baseNode(const OutEdgeIt &e) const {
function Node (line 660) | Node runningNode(const OutEdgeIt &e) const {
function Node (line 667) | Node baseNode(const InEdgeIt &e) const {
function Node (line 674) | Node runningNode(const InEdgeIt &e) const {
function class (line 678) | class IncEdgeIt : public Parent::UEdge {
function Node (line 707) | Node baseNode(const IncEdgeIt &e) const {
function Node (line 714) | Node runningNode(const IncEdgeIt &e) const {
function Node (line 718) | Node oppositeNode(const Node &n, const UEdge &e) const {
function Edge (line 727) | Edge oppositeEdge(const Edge &e) const {
function Edge (line 732) | Edge direct(const UEdge &ue, const Node &s) const {
FILE: src/lemon/bits/graph_extender.h
function namespace (line 35) | namespace lemon {
function Node (line 194) | Node baseNode(const OutEdgeIt &e) const {
function Node (line 201) | Node runningNode(const OutEdgeIt &e) const {
function Node (line 208) | Node baseNode(const InEdgeIt &e) const {
function Node (line 215) | Node runningNode(const InEdgeIt &e) const {
type GraphExtender (line 224) | typedef GraphExtender Graph;
type MapExtender (line 225) | typedef MapExtender<DefaultMap<Graph, Node, _Value> > Parent;
function explicit (line 227) | explicit NodeMap(const Graph& graph)
type GraphExtender (line 248) | typedef GraphExtender Graph;
type MapExtender (line 249) | typedef MapExtender<DefaultMap<Graph, Edge, _Value> > Parent;
function explicit (line 251) | explicit EdgeMap(const Graph& graph)
function Node (line 268) | Node addNode() {
function Edge (line 274) | Edge addEdge(const Node& from, const Node& to) {
function clear (line 280) | void clear() {
function erase (line 293) | void erase(const Node& node) {
function erase (line 311) | void erase(const Edge& edge) {
type UGraphExtender (line 336) | typedef UGraphExtender Graph;
type True (line 338) | typedef True UndirectedTag;
type typename (line 340) | typedef typename Parent::Node Node;
type typename (line 341) | typedef typename Parent::Edge Edge;
type typename (line 342) | typedef typename Parent::UEdge UEdge;
function maxId (line 346) | int maxId(Node) const {
function maxId (line 350) | int maxId(Edge) const {
function maxId (line 354) | int maxId(UEdge) const {
function Node (line 358) | Node fromId(int id, Node) const {
function Edge (line 362) | Edge fromId(int id, Edge) const {
function UEdge (line 366) | UEdge fromId(int id, UEdge) const {
function Node (line 370) | Node oppositeNode(const Node &n, const UEdge &e) const {
function Edge (line 379) | Edge oppositeEdge(const Edge &e) const {
function Edge (line 384) | Edge direct(const UEdge &ue, const Node &s) const {
type AlterationNotifier (line 390) | typedef AlterationNotifier<UGraphExtender, Node> NodeNotifier;
type AlterationNotifier (line 391) | typedef AlterationNotifier<UGraphExtender, Edge> EdgeNotifier;
type AlterationNotifier (line 392) | typedef AlterationNotifier<UGraphExtender, UEdge> UEdgeNotifier;
function class (line 417) | class NodeIt : public Node {
function class (line 440) | class EdgeIt : public Edge {
function class (line 463) | class OutEdgeIt : public Edge {
function class (line 487) | class InEdgeIt : public Edge {
function class (line 511) | class UEdgeIt : public Parent::UEdge {
function class (line 533) | class IncEdgeIt : public Parent::UEdge {
function Node (line 561) | Node baseNode(const OutEdgeIt &e) const {
function Node (line 568) | Node runningNode(const OutEdgeIt &e) const {
function Node (line 575) | Node baseNode(const InEdgeIt &e) const {
function Node (line 582) | Node runningNode(const InEdgeIt &e) const {
function Node (line 589) | Node baseNode(const IncEdgeIt &e) const {
function Node (line 595) | Node runningNode(const IncEdgeIt &e) const {
type UGraphExtender (line 605) | typedef UGraphExtender Graph;
type MapExtender (line 606) | typedef MapExtender<DefaultMap<Graph, Node, _Value> > Parent;
function Parent (line 608) | NodeMap(const Graph& graph)
type UGraphExtender (line 629) | typedef UGraphExtender Graph;
type MapExtender (line 630) | typedef MapExtender<DefaultMap<Graph, Edge, _Value> > Parent;
function Parent (line 632) | EdgeMap(const Graph& graph)
type UGraphExtender (line 653) | typedef UGraphExtender Graph;
type MapExtender (line 654) | typedef MapExtender<DefaultMap<Graph, UEdge, _Value> > Parent;
function Parent (line 656) | UEdgeMap(const Graph& graph)
function Node (line 676) | Node addNode() {
function UEdge (line 682) | UEdge addEdge(const Node& from, const Node& to) {
function clear (line 692) | void clear() {
function erase (line 708) | void erase(const Node& node) {
function erase (line 726) | void erase(const UEdge& uedge) {
type BpUGraphExtender (line 757) | typedef BpUGraphExtender Graph;
type True (line 759) | typedef True UndirectedTag;
type typename (line 761) | typedef typename Parent::Node Node;
type typename (line 762) | typedef typename Parent::ANode ANode;
type typename (line 763) | typedef typename Parent::BNode BNode;
type typename (line 764) | typedef typename Parent::Edge Edge;
type typename (line 765) | typedef typename Parent::UEdge UEdge;
function Node (line 768) | Node oppositeNode(const Node& node, const UEdge& edge) const {
function Edge (line 774) | Edge direct(const UEdge& edge, const Node& node) const {
function Edge (line 778) | Edge oppositeEdge(const Edge& edge) const {
function maxId (line 782) | int maxId(Node) const {
function maxId (line 785) | int maxId(BNode) const {
function maxId (line 788) | int maxId(ANode) const {
function maxId (line 791) | int maxId(Edge) const {
function maxId (line 794) | int maxId(UEdge) const {
function Node (line 799) | Node fromId(int id, Node) const {
function ANode (line 802) | ANode fromId(int id, ANode) const {
function BNode (line 805) | BNode fromId(int id, BNode) const {
function Edge (line 808) | Edge fromId(int id, Edge) const {
function UEdge (line 811) | UEdge fromId(int id, UEdge) const {
type AlterationNotifier (line 815) | typedef AlterationNotifier<BpUGraphExtender, ANode> ANodeNotifier;
type AlterationNotifier (line 816) | typedef AlterationNotifier<BpUGraphExtender, BNode> BNodeNotifier;
type AlterationNotifier (line 817) | typedef AlterationNotifier<BpUGraphExtender, Node> NodeNotifier;
type AlterationNotifier (line 818) | typedef AlterationNotifier<BpUGraphExtender, Edge> EdgeNotifier;
type AlterationNotifier (line 819) | typedef AlterationNotifier<BpUGraphExtender, UEdge> UEdgeNotifier;
function class (line 851) | class NodeIt : public Node {
function class (line 873) | class ANodeIt : public Node {
function class (line 895) | class BNodeIt : public Node {
function class (line 917) | class EdgeIt : public Edge {
function class (line 940) | class UEdgeIt : public UEdge {
function class (line 962) | class OutEdgeIt : public Edge {
function class (line 987) | class InEdgeIt : public Edge {
function Node (line 1014) | Node baseNode(const OutEdgeIt &e) const {
function Node (line 1021) | Node runningNode(const OutEdgeIt &e) const {
function Node (line 1028) | Node baseNode(const InEdgeIt &e) const {
function Node (line 1035) | Node runningNode(const InEdgeIt &e) const {
function class (line 1039) | class IncEdgeIt : public Parent::UEdge {
function Node (line 1068) | Node baseNode(const IncEdgeIt &e) const {
function Node (line 1075) | Node runningNode(const IncEdgeIt &e) const {
type BpUGraphExtender (line 1083) | typedef BpUGraphExtender Graph;
type MapExtender (line 1084) | typedef MapExtender<DefaultMap<Graph, ANode, _Value> > Parent;
function Parent (line 1086) | ANodeMap(const Graph& graph)
type BpUGraphExtender (line 1107) | typedef BpUGraphExtender Graph;
type MapExtender (line 1108) | typedef MapExtender<DefaultMap<Graph, BNode, _Value> > Parent;
function Parent (line 1110) | BNodeMap(const Graph& graph)
type Node (line 1134) | typedef Node Key;
type _Value (line 1135) | typedef _Value Value;
type typename (line 1138) | typedef typename ANodeMap<_Value>::Reference Reference;
type typename (line 1140) | typedef typename ANodeMap<_Value>::ConstReference ConstReference;
type True (line 1142) | typedef True ReferenceMapTag;
function ConstReference (line 1161) | ConstReference operator[](const Key& node) const {
function Reference (line 1169) | Reference operator[](const Key& node) {
function set (line 1177) | void set(const Key& node, const Value& value) {
function class (line 1185) | class MapIt : public NodeIt {
function class (line 1209) | class ConstMapIt : public NodeIt {
function class (line 1225) | class ItemIt : public NodeIt {
type BpUGraphExtender (line 1246) | typedef BpUGraphExtender Graph;
type MapExtender (line 1247) | typedef MapExtender<DefaultMap<Graph, Edge, _Value> > Parent;
function Parent (line 1249) | EdgeMap(const Graph& graph)
type BpUGraphExtender (line 1269) | typedef BpUGraphExtender Graph;
type MapExtender (line 1270) | typedef MapExtender<DefaultMap<Graph, UEdge, _Value> > Parent;
function Parent (line 1272) | UEdgeMap(const Graph& graph)
function Node (line 1289) | Node addANode() {
function Node (line 1296) | Node addBNode() {
function UEdge (line 1303) | UEdge addEdge(const Node& s, const Node& t) {
function clear (line 1315) | void clear() {
function erase (line 1336) | void erase(const Node& node) {
function erase (line 1358) | void erase(const UEdge& uedge) {
function Edge (line 1384) | Edge findEdge(Node u, Node v, Edge prev = INVALID) const {
FILE: src/lemon/bits/invalid.h
function namespace (line 25) | namespace lemon {
FILE: src/lemon/bits/map_extender.h
function namespace (line 32) | namespace lemon {
FILE: src/lemon/bits/path_dump.h
function namespace (line 22) | namespace lemon {
type _Graph (line 100) | typedef _Graph Graph;
type typename (line 101) | typedef typename Graph::Edge Edge;
type _PredMatrixMap (line 102) | typedef _PredMatrixMap PredMatrixMap;
function length (line 111) | int length() const {
function class (line 126) | class RevEdgeIt {
FILE: src/lemon/bits/traits.h
function namespace (line 28) | namespace lemon {
FILE: src/lemon/bits/utility.h
function namespace (line 45) | namespace lemon
type T (line 118) | typedef T type;
FILE: src/lemon/bits/variant.h
function namespace (line 27) | namespace lemon {
function First (line 189) | const First& first() const {
type typename (line 251) | typedef typename _TypeMap::template Map<_idx>::Type Current;
function destroy (line 253) | static void destroy(int index, char* place) {
function copy (line 261) | static void copy(int index, char* to, const char* from) {
function destroy (line 275) | static void destroy(int, char*) {
function copy (line 279) | static void copy(int, char*, const char*) {
type _TypeMap (line 339) | typedef _TypeMap TypeMap;
type WrongStateError (line 341) | struct WrongStateError
function namespace (line 446) | namespace _variant_bits {
FILE: src/lemon/bits/vector_map.h
function namespace (line 37) | namespace lemon {
FILE: src/lemon/bucket_heap.h
function namespace (line 30) | namespace lemon {
FILE: src/lemon/concept_check.h
function namespace (line 39) | namespace lemon {
FILE: src/lemon/concepts/bpugraph.h
function namespace (line 33) | namespace lemon {
function class (line 616) | class OutEdgeIt : public Edge {
function class (line 668) | class InEdgeIt : public Edge {
function Edge (line 845) | Edge direct(const UEdge&, const Node&) const {
function Edge (line 855) | Edge direct(const UEdge&, bool) const {
function aNode (line 862) | bool aNode(Node) const { return true;}
function bNode (line 867) | bool bNode(Node) const { return true;}
function Node (line 872) | Node aNode(UEdge) const { return INVALID;}
function Node (line 877) | Node bNode(UEdge) const { return INVALID;}
function direction (line 883) | bool direction(Edge) const { return true; }
function Edge (line 888) | Edge oppositeEdge(Edge) const { return INVALID; }
function Node (line 893) | Node oppositeNode(Node, UEdge) const { return INVALID; }
function Node (line 906) | Node source(UEdge) const { return INVALID; }
function Node (line 909) | Node target(UEdge) const { return INVALID; }
function Node (line 912) | Node source(Edge) const { return INVALID; }
function Node (line 915) | Node target(Edge) const { return INVALID; }
function Node (line 920) | Node baseNode(OutEdgeIt e) const {
function Node (line 928) | Node runningNode(OutEdgeIt e) const {
function Node (line 935) | Node baseNode(InEdgeIt e) const {
function Node (line 942) | Node runningNode(InEdgeIt e) const {
function Node (line 949) | Node baseNode(IncEdgeIt) const {
function Node (line 956) | Node runningNode(IncEdgeIt) const {
function first (line 960) | void first(Node&) const {}
function next (line 961) | void next(Node&) const {}
function first (line 963) | void first(Edge&) const {}
function next (line 964) | void next(Edge&) const {}
function first (line 966) | void first(UEdge&) const {}
function next (line 967) | void next(UEdge&) const {}
function firstANode (line 969) | void firstANode(Node&) const {}
function nextANode (line 970) | void nextANode(Node&) const {}
function firstBNode (line 972) | void firstBNode(Node&) const {}
function nextBNode (line 973) | void nextBNode(Node&) const {}
function firstIn (line 975) | void firstIn(Edge&, const Node&) const {}
function nextIn (line 976) | void nextIn(Edge&) const {}
function firstOut (line 978) | void firstOut(Edge&, const Node&) const {}
function nextOut (line 979) | void nextOut(Edge&) const {}
FILE: src/lemon/concepts/graph.h
function namespace (line 33) | namespace concepts {
FILE: src/lemon/concepts/graph_components.h
function namespace (line 32) | namespace lemon {
type typename (line 1814) | typedef typename _Base::Node Node;
type typename (line 1815) | typedef typename _Base::Edge Edge;
function Node (line 1821) | Node addNode() {
function Edge (line 1828) | Edge addEdge(const Node&, const Node&) {
function constraints (line 1834) | void constraints() {
type typename (line 1859) | typedef typename _Base::Node Node;
type typename (line 1860) | typedef typename _Base::UEdge UEdge;
function Node (line 1866) | Node addNode() {
function UEdge (line 1873) | UEdge addEdge(const Node&, const Node&) {
function constraints (line 1879) | void constraints() {
function constraints (line 1907) | void constraints() {
type typename (line 1924) | typedef typename Base::Node Node;
type typename (line 1925) | typedef typename Base::Edge Edge;
function erase (line 1931) | void erase(const Node&) {}
function erase (line 1937) | void erase(const Edge&) {}
function constraints (line 1941) | void constraints() {
type typename (line 1964) | typedef typename Base::Node Node;
type typename (line 1965) | typedef typename Base::UEdge UEdge;
function erase (line 1971) | void erase(const Node&) {}
function erase (line 1977) | void erase(const UEdge&) {}
function constraints (line 1981) | void constraints() {
type _Base (line 2004) | typedef _Base Base;
function constraints (line 2008) | void constraints() {
function clear (line 2030) | void clear() {}
function constraints (line 2034) | void constraints() {
type _Base (line 2053) | typedef _Base Base;
function constraints (line 2057) | void constraints() {
type _Base (line 2077) | typedef _Base Base;
function constraints (line 2081) | void constraints() {
FILE: src/lemon/concepts/heap.h
function namespace (line 29) | namespace lemon {
FILE: src/lemon/concepts/maps.h
function namespace (line 29) | namespace lemon {
FILE: src/lemon/concepts/matrix_maps.h
function namespace (line 29) | namespace lemon {
FILE: src/lemon/concepts/path.h
function namespace (line 32) | namespace lemon {
FILE: src/lemon/concepts/ugraph.h
function class (line 69) | class UGraph {
function class (line 409) | class OutEdgeIt : public Edge {
function class (line 461) | class InEdgeIt : public Edge {
function Edge (line 575) | Edge direct(const UEdge&, const Node&) const {
function Edge (line 585) | Edge direct(const UEdge&, bool) const {
function direction (line 593) | bool direction(Edge) const { return true; }
function Edge (line 598) | Edge oppositeEdge(Edge) const { return INVALID; }
function Node (line 603) | Node oppositeNode(Node, UEdge) const { return INVALID; }
function Node (line 616) | Node source(UEdge) const { return INVALID; }
function Node (line 619) | Node target(UEdge) const { return INVALID; }
function Node (line 622) | Node source(Edge) const { return INVALID; }
function Node (line 625) | Node target(Edge) const { return INVALID; }
function first (line 627) | void first(Node&) const {}
function next (line 628) | void next(Node&) const {}
function first (line 630) | void first(UEdge&) const {}
function next (line 631) | void next(UEdge&) const {}
function first (line 633) | void first(Edge&) const {}
function next (line 634) | void next(Edge&) const {}
function firstOut (line 636) | void firstOut(Edge&, Node) const {}
function nextOut (line 637) | void nextOut(Edge&) const {}
function firstIn (line 639) | void firstIn(Edge&, Node) const {}
function nextIn (line 640) | void nextIn(Edge&) const {}
function firstInc (line 643) | void firstInc(UEdge &, bool &, const Node &) const {}
function Node (line 663) | Node baseNode(InEdgeIt e) const {
function Node (line 670) | Node runningNode(InEdgeIt e) const {
function Node (line 677) | Node baseNode(IncEdgeIt) const {
function Node (line 684) | Node runningNode(IncEdgeIt) const {
function constraints (line 690) | void constraints() {
FILE: src/lemon/dfs.h
type GR (line 46) | typedef GR Graph;
type typename (line 54) | typedef typename Graph::template
function PredMap (line 60) | static PredMap *createPredMap(const GR &G)
type NullMap (line 70) | typedef NullMap<typename
function ProcessedMap (line 79) | static ProcessedMap *createProcessedMap(const GR &)
type typename (line 89) | typedef typename Graph::template
function ReachedMap (line 95) | static ReachedMap *createReachedMap(const GR &G)
type typename (line 104) | typedef typename Graph::template
function DistMap (line 109) | static DistMap *createDistMap(const GR &G)
type TR (line 152) | typedef TR Traits;
type typename (line 154) | typedef typename TR::Graph Graph;
type typename (line 156) | typedef typename Graph::Node Node;
type typename (line 158) | typedef typename Graph::NodeIt NodeIt;
type typename (line 160) | typedef typename Graph::Edge Edge;
type typename (line 162) | typedef typename Graph::OutEdgeIt OutEdgeIt;
type typename (line 166) | typedef typename TR::PredMap PredMap;
type typename (line 168) | typedef typename TR::ReachedMap ReachedMap;
type typename (line 170) | typedef typename TR::ProcessedMap ProcessedMap;
type typename (line 172) | typedef typename TR::DistMap DistMap;
function create_maps (line 199) | void create_maps()
type T (line 233) | typedef T PredMap;
function PredMap (line 234) | static PredMap *createPredMap(const Graph &G)
type T (line 252) | typedef T DistMap;
function DistMap (line 253) | static DistMap *createDistMap(const Graph &)
type Dfs (line 265) | typedef Dfs<Graph, DefDistMapTraits<T> > Create;
type T (line 270) | typedef T ReachedMap;
function ReachedMap (line 271) | static ReachedMap *createReachedMap(const Graph &)
type T (line 288) | typedef T ProcessedMap;
function ProcessedMap (line 289) | static ProcessedMap *createProcessedMap(const Graph &)
function Traits (line 304) | struct DefGraphProcessedMapTraits : public Traits {
function addSource (line 452) | void addSource(Node s)
function Edge (line 477) | Edge processNextEdge()
function OutEdgeIt (line 508) | OutEdgeIt nextEdge()
function emptyQueue (line 518) | bool emptyQueue() { return _stack_head<0; }
function queueSize (line 522) | int queueSize() { return _stack_head+1; }
function start (line 538) | void start()
function start (line 557) | void start(Node dest)
function run (line 604) | void run() {
function run (line 629) | void run(Node s) {
function run (line 648) | int run(Node s,Node t) {
type PredMapPath (line 665) | typedef PredMapPath<Graph, PredMap> Path;
function Path (line 671) | Path path(Node t)
function dist (line 682) | int dist(Node v) const { return (*_dist)[v]; }
function Edge (line 695) | Edge predEdge(Node v) const { return (*_pred)[v];}
function Node (line 709) | Node predNode(Node v) const { return (*_pred)[v]==INVALID ? INVALID:
function reached (line 734) | bool reached(Node v) { return (*_reached)[v]; }
type GR (line 747) | typedef GR Graph;
type NullMap (line 755) | typedef NullMap<typename
function PredMap (line 764) | static PredMap *createPredMap(const GR &)
type NullMap (line 775) | typedef NullMap<typename
function ProcessedMap (line 784) | static ProcessedMap *createProcessedMap(const GR &)
type typename (line 794) | typedef typename Graph::template
function ReachedMap (line 800) | static ReachedMap *createReachedMap(const GR &G)
type NullMap (line 809) | typedef NullMap<typename
function DistMap (line 817) | static DistMap *createDistMap(const GR &)
type DfsWizardDefaultTraits (line 836) | typedef DfsWizardDefaultTraits<GR> Base;
type TR (line 897) | typedef TR Base;
type typename (line 900) | typedef typename TR::Graph Graph;
type typename (line 902) | typedef typename Graph::Node Node;
type typename (line 904) | typedef typename Graph::NodeIt NodeIt;
type typename (line 906) | typedef typename Graph::Edge Edge;
type typename (line 908) | typedef typename Graph::OutEdgeIt OutEdgeIt;
type typename (line 912) | typedef typename TR::ReachedMap ReachedMap;
type typename (line 915) | typedef typename TR::ProcessedMap ProcessedMap;
type typename (line 918) | typedef typename TR::PredMap PredMap;
type typename (line 920) | typedef typename TR::DistMap DistMap;
function TR (line 934) | DfsWizard(const TR &b) : TR(b) {}
function run (line 942) | void run()
function run (line 961) | void run(Node s)
type T (line 969) | typedef T PredMap;
function PredMap (line 970) | static PredMap *createPredMap(const Graph &) { return 0; }
function TR (line 971) | DefPredMapBase(const TR &b) : TR(b) {}
type T (line 990) | typedef T ReachedMap;
function ReachedMap (line 991) | static ReachedMap *createReachedMap(const Graph &) { return 0; }
function TR (line 992) | DefReachedMapBase(const TR &b) : TR(b) {}
type T (line 1011) | typedef T ProcessedMap;
function ProcessedMap (line 1012) | static ProcessedMap *createProcessedMap(const Graph &) { return 0; }
function TR (line 1013) | DefProcessedMapBase(const TR &b) : TR(b) {}
type T (line 1031) | typedef T DistMap;
function DistMap (line 1032) | static DistMap *createDistMap(const Graph &) { return 0; }
function TR (line 1033) | DefDistMapBase(const TR &b) : TR(b) {}
type _Graph (line 1092) | typedef _Graph Graph;
type typename (line 1093) | typedef typename Graph::Edge Edge;
type typename (line 1094) | typedef typename Graph::Node Node;
function discover (line 1099) | void discover(const Edge& edge) {}
function reach (line 1103) | void reach(const Node& node) {}
function backtrack (line 1107) | void backtrack(const Edge& edge) {}
function leave (line 1111) | void leave(const Node& node) {}
function examine (line 1117) | void examine(const Edge& edge) {}
function start (line 1121) | void start(const Node& node) {}
function stop (line 1125) | void stop(const Node& node) {}
type _Graph (line 1131) | typedef _Graph Graph;
type typename (line 1132) | typedef typename Graph::Edge Edge;
type typename (line 1133) | typedef typename Graph::Node Node;
function discover (line 1134) | void discover(const Edge&) {}
function reach (line 1135) | void reach(const Node&) {}
function backtrack (line 1136) | void backtrack(const Edge&) {}
function leave (line 1137) | void leave(const Node&) {}
function examine (line 1138) | void examine(const Edge&) {}
function start (line 1139) | void start(const Node&) {}
function stop (line 1140) | void stop(const Node&) {}
function constraints (line 1144) | void constraints() {
type _Graph (line 1168) | typedef _Graph Graph;
type typename (line 1175) | typedef typename Graph::template
function ReachedMap (line 1182) | static ReachedMap *createReachedMap(const Graph &graph) {
function class (line 1226) | class UninitializedParameter : public lemon::UninitializedParameter {
type _Traits (line 1234) | typedef _Traits Traits;
type typename (line 1236) | typedef typename Traits::Graph Graph;
type _Visitor (line 1238) | typedef _Visitor Visitor;
type typename (line 1241) | typedef typename Traits::ReachedMap ReachedMap;
type typename (line 1246) | typedef typename Graph::NodeIt NodeIt;
type typename (line 1247) | typedef typename Graph::Edge Edge;
type typename (line 1248) | typedef typename Graph::OutEdgeIt OutEdgeIt;
function create_maps (line 1265) | void create_maps() {
type T (line 1285) | typedef T ReachedMap;
function ReachedMap (line 1286) | static ReachedMap *createReachedMap(const Graph &graph) {
function addSource (line 1365) | void addSource(Node s) {
function Edge (line 1387) | Edge processNextEdge() {
function Edge (line 1420) | Edge nextEdge() {
function emptyQueue (line 1429) | bool emptyQueue() { return _stack_head < 0; }
function queueSize (line 1434) | int queueSize() { return _stack_head + 1; }
function start (line 1442) | void start() {
function start (line 1452) | void start(Node dest) {
function run (line 1488) | void run(Node s) {
function run (line 1511) | void run() {
function reached (line 1535) | bool reached(Node v) { return (*_reached)[v]; }
FILE: src/lemon/error.h
function namespace (line 33) | namespace lemon {
function class (line 101) | class ErrorMessage {
function class (line 173) | class Exception : public std::exception {
function class (line 194) | class LogicError : public Exception {
function class (line 207) | class UninitializedParameter : public LogicError {
function class (line 222) | class RuntimeError : public Exception {
function class (line 230) | class RangeError : public RuntimeError {
function class (line 238) | class IoError : public RuntimeError {
function class (line 246) | class DataFormatError : public IoError {
function line (line 269) | void line(int ln) { _line = ln; }
function message (line 271) | void message(const std::string& msg) { _message.set(msg); }
function file (line 273) | void file(const std::string &fl) { _file.set(fl); }
function virtual (line 298) | virtual const char* what() const throw() {
function virtual (line 317) | virtual ~DataFormatError() throw() {}
function class (line 321) | class FileOpenError : public IoError {
function class (line 365) | class IoParameterError : public IoError {
function file (line 387) | void file(const std::string &fl) { _file.set(fl); }
function virtual (line 410) | virtual const char* what() const throw() {
function virtual (line 421) | virtual ~IoParameterError() throw() {}
function class (line 426) | class AssertionFailedError : public LogicError {
function virtual (line 454) | virtual const char* what() const throw() {
function virtual (line 470) | virtual ~AssertionFailedError() throw() {}
FILE: src/lemon/fib_heap.h
function namespace (line 30) | namespace lemon {
FILE: src/lemon/graph_adaptor.h
function namespace (line 41) | namespace lemon {
type GraphAdaptorBase (line 228) | typedef GraphAdaptorBase<_Graph> Parent;
type typename (line 233) | typedef typename Parent::Edge Edge;
function firstIn (line 235) | void firstIn(Edge& i, const Node& n) const { Parent::firstOut(i, n); }
function firstOut (line 236) | void firstOut(Edge& i, const Node& n ) const { Parent::firstIn(i, n); }
function nextIn (line 238) | void nextIn(Edge& i) const { Parent::nextOut(i); }
function nextOut (line 239) | void nextOut(Edge& i) const { Parent::nextIn(i); }
function Node (line 241) | Node source(const Edge& e) const { return Parent::target(e); }
function Node (line 242) | Node target(const Edge& e) const { return Parent::source(e); }
type FindEdgeTagIndicator (line 244) | typedef FindEdgeTagIndicator<Graph> FindEdgeTag;
function Edge (line 245) | Edge findEdge(const Node& u, const Node& v,
type GraphAdaptorExtender (line 306) | typedef GraphAdaptorExtender<
type SubGraphAdaptorBase (line 328) | typedef SubGraphAdaptorBase Adaptor;
type GraphAdaptorBase (line 329) | typedef GraphAdaptorBase<_Graph> Parent;
function setNodeFilterMap (line 336) | void setNodeFilterMap(NodeFilterMap& _node_filter_map) {
function setEdgeFilterMap (line 339) | void setEdgeFilterMap(EdgeFilterMap& _edge_filter_map) {
type typename (line 346) | typedef typename Parent::Edge Edge;
function first (line 348) | void first(Node& i) const {
function first (line 353) | void first(Edge& i) const {
function firstIn (line 360) | void firstIn(Edge& i, const Node& n) const {
function firstOut (line 366) | void firstOut(Edge& i, const Node& n) const {
function next (line 372) | void next(Node& i) const {
function next (line 377) | void next(Edge& i) const {
function nextIn (line 384) | void nextIn(Edge& i) const {
function nextOut (line 390) | void nextOut(Edge& i) const {
function hide (line 401) | void hide(const Node& n) const { node_filter_map->set(n, false); }
function hide (line 408) | void hide(const Edge& e) const { edge_filter_map->set(e, false); }
function unHide (line 415) | void unHide(const Node& n) const { node_filter_map->set(n, true); }
function unHide (line 422) | void unHide(const Edge& e) const { edge_filter_map->set(e, true); }
function hidden (line 428) | bool hidden(const Node& n) const { return !(*node_filter_map)[n]; }
function hidden (line 434) | bool hidden(const Edge& e) const { return !(*edge_filter_map)[e]; }
type False (line 436) | typedef False NodeNumTag;
type False (line 437) | typedef False EdgeNumTag;
type FindEdgeTagIndicator (line 439) | typedef FindEdgeTagIndicator<Graph> FindEdgeTag;
function Edge (line 440) | Edge findEdge(const Node& source, const Node& target,
function Parent (line 462) | NodeMap(const Graph& g)
function Parent (line 488) | EdgeMap(const Graph& g)
type SubGraphAdaptorBase (line 511) | typedef SubGraphAdaptorBase Adaptor;
type GraphAdaptorBase (line 512) | typedef GraphAdaptorBase<_Graph> Parent;
function setNodeFilterMap (line 519) | void setNodeFilterMap(NodeFilterMap& _node_filter_map) {
function setEdgeFilterMap (line 522) | void setEdgeFilterMap(EdgeFilterMap& _edge_filter_map) {
type typename (line 529) | typedef typename Parent::Edge Edge;
function first (line 531) | void first(Node& i) const {
function first (line 536) | void first(Edge& i) const {
function firstIn (line 541) | void firstIn(Edge& i, const Node& n) const {
function firstOut (line 546) | void firstOut(Edge& i, const Node& n) const {
function next (line 551) | void next(Node& i) const {
function next (line 555) | void next(Edge& i) const {
function nextIn (line 559) | void nextIn(Edge& i) const {
function nextOut (line 564) | void nextOut(Edge& i) const {
function hide (line 574) | void hide(const Node& n) const { node_filter_map->set(n, false); }
function hide (line 581) | void hide(const Edge& e) const { edge_filter_map->set(e, false); }
function unHide (line 588) | void unHide(const Node& n) const { node_filter_map->set(n, true); }
function unHide (line 595) | void unHide(const Edge& e) const { edge_filter_map->set(e, true); }
function hidden (line 601) | bool hidden(const Node& n) const { return !(*node_filter_map)[n]; }
function hidden (line 607) | bool hidden(const Edge& e) const { return !(*edge_filter_map)[e]; }
type False (line 609) | typedef False NodeNumTag;
type False (line 610) | typedef False EdgeNumTag;
type FindEdgeTagIndicator (line 612) | typedef FindEdgeTagIndicator<Graph> FindEdgeTag;
function Edge (line 613) | Edge findEdge(const Node& source, const Node& target,
function Parent (line 635) | NodeMap(const Graph& g)
function Parent (line 661) | EdgeMap(const Graph& g)
type GraphAdaptorExtender (line 745) | typedef GraphAdaptorExtender< SubGraphAdaptorBase<_Graph, NodeFilterMap,
function const_true_map (line 823) | const_true_map(true) {
function const_true_map (line 999) | const_true_map(true) {
type UndirGraphAdaptorBase (line 1034) | typedef UndirGraphAdaptorBase Adaptor;
type UndirGraphExtender (line 1035) | typedef UndirGraphExtender<GraphAdaptorBase<_Graph> > Parent;
type typename (line 1044) | typedef typename Parent::Edge Edge;
type _Value (line 1058) | typedef _Value Value;
type Edge (line 1059) | typedef Edge Key;
function typename (line 1075) | typename MapTraits<MapImpl>::ConstReturnValue operator[](Edge e) const {
function typename (line 1083) | typename MapTraits<MapImpl>::ReturnValue operator[](Edge e) {
type Adaptor (line 1104) | typedef Adaptor Graph;
type SubMapExtender (line 1105) | typedef SubMapExtender<Adaptor, EdgeMapBase<_Value> > Parent;
function Parent (line 1107) | EdgeMap(const Graph& g)
function explicit (line 1129) | explicit UEdgeMap(const Adaptor& ga)
type InvalidType (line 1162) | typedef InvalidType EdgeNotifier;
type _Graph (line 1174) | typedef _Graph Graph;
type typename (line 1175) | typedef typename _Graph::Edge GraphEdge;
function setGraph (line 1182) | void setGraph(_Graph& g) {
type typename (line 1193) | typedef typename Parent::UEdge UEdge;
type typename (line 1194) | typedef typename Parent::Edge Edge;
type typename (line 1196) | typedef typename Parent::EdgeNotifier UEdgeNotifier;
type AlterationNotifier (line 1200) | typedef AlterationNotifier<AlterableUndirGraphAdaptor,
type AlterableUndirGraphAdaptor (line 1210) | typedef AlterableUndirGraphAdaptor AdaptorBase;
function setNotifier (line 1222) | void setNotifier(typename Graph::EdgeNotifier& nf) {
function virtual (line 1235) | virtual void add(const std::vector<GraphEdge>& ge) {
function virtual (line 1243) | virtual void erase(const GraphEdge& ge) {
function virtual (line 1249) | virtual void erase(const std::vector<GraphEdge>& ge) {
function virtual (line 1257) | virtual void build() {
function virtual (line 1260) | virtual void clear() {
type AlterableUndirGraphAdaptor (line 1323) | typedef AlterableUndirGraphAdaptor<_Graph> Parent;
type _BackwardMap (line 1344) | typedef _BackwardMap BackwardMap;
type typename (line 1346) | typedef typename MapTraits<ForwardMap>::ReferenceMapTag ReferenceMapTag;
type typename (line 1348) | typedef typename ForwardMap::Value Value;
type typename (line 1349) | typedef typename Parent::Edge Key;
function set (line 1366) | void set(const Key& e, const Value& a) {
function typename (line 1377) | typename MapTraits<ForwardMap>::ConstReturnValue
function typename (line 1389) | typename MapTraits<ForwardMap>::ReturnValue
function setForwardMap (line 1401) | void setForwardMap(ForwardMap& _forward_map) {
function setBackwardMap (line 1408) | void setBackwardMap(BackwardMap& _backward_map) {
type Value (line 1439) | typedef bool Value;
function setCapacity (line 1448) | void setCapacity(const CapacityMap& _capacity) { capacity = &_capacity; }
function setFlow (line 1449) | void setFlow(const FlowMap& _flow) { flow = &_flow; }
function const (line 1451) | bool operator[](const typename Graph::Edge& e) const {
type Value (line 1465) | typedef bool Value;
function setCapacity (line 1472) | void setCapacity(const CapacityMap& _capacity) { capacity = &_capacity; }
function setFlow (line 1473) | void setFlow(const FlowMap& _flow) { flow = &_flow; }
function const (line 1474) | bool operator[](const typename Graph::Edge& e) const {
type ResForwardFilter (line 1529) | typedef ResForwardFilter<const Graph, Number, CapacityMap, FlowMap>
type ResBackwardFilter (line 1532) | typedef ResBackwardFilter<const Graph, Number, CapacityMap, FlowMap>
type typename (line 1535) | typedef typename UGraph::
type EdgeSubGraphAdaptor (line 1539) | typedef EdgeSubGraphAdaptor<UGraph, EdgeFilter> Parent;
function setCapacityMap (line 1551) | void setCapacityMap(const CapacityMap& _capacity) {
function setFlowMap (line 1557) | void setFlowMap(FlowMap& _flow) {
type typename (line 1580) | typedef typename Parent::Edge Edge;
function Number (line 1585) | Number rescap(const Edge& edge) const {
function augment (line 1598) | void augment(const Edge& e, Number a) const {
function forward (line 1609) | static bool forward(const Edge& e) {
function backward (line 1616) | static bool backward(const Edge& e) {
function Edge (line 1623) | static Edge forward(const typename Graph::Edge& e) {
function Edge (line 1630) | static Edge backward(const typename Graph::Edge& e) {
function class (line 1638) | class ResCap {
type GraphAdaptorBase (line 1661) | typedef GraphAdaptorBase<_Graph> Parent;
function setFirstOutEdgesMap (line 1667) | void setFirstOutEdgesMap(FirstOutEdgesMap& _first_out_edges) {
type typename (line 1674) | typedef typename Parent::Edge Edge;
function firstOut (line 1676) | void firstOut(Edge& i, const Node& n) const {
function erase (line 1680) | void erase(const Edge& e) const {
type _Graph (line 1708) | typedef _Graph Graph;
type GraphAdaptorExtender (line 1709) | typedef GraphAdaptorExtender<
type GraphAdaptorBase (line 1732) | typedef GraphAdaptorBase<const _Graph> Parent;
type typename (line 1734) | typedef typename Graph::Node GraphNode;
type typename (line 1735) | typedef typename Graph::Edge GraphEdge;
function class (line 1744) | class Node : public GraphNode {
function operator (line 1762) | bool operator!=(const Node& node) const {
function operator (line 1766) | bool operator<(const Node& node) const {
function class (line 1772) | class Edge {
function first (line 1823) | void first(Node& n) const {
function next (line 1828) | void next(Node& n) const {
function first (line 1837) | void first(Edge& e) const {
function next (line 1846) | void next(Edge& e) const {
function firstOut (line 1858) | void firstOut(Edge& e, const Node& n) const {
function nextOut (line 1867) | void nextOut(Edge& e) const {
function firstIn (line 1875) | void firstIn(Edge& e, const Node& n) const {
function nextIn (line 1884) | void nextIn(Edge& e) const {
function Node (line 1892) | Node source(const Edge& e) const {
function Node (line 1900) | Node target(const Edge& e) const {
function id (line 1908) | int id(const Node& n) const {
function Node (line 1911) | Node nodeFromId(int ix) const {
function id (line 1918) | int id(const Edge& e) const {
function Edge (line 1925) | Edge edgeFromId(int ix) const {
function maxEdgeId (line 1932) | int maxEdgeId() const {
function outNode (line 1947) | static bool outNode(const Node& n) {
function origEdge (line 1954) | static bool origEdge(const Edge& e) {
function bindEdge (line 1961) | static bool bindEdge(const Edge& e) {
function Node (line 1968) | static Node inNode(const GraphNode& n) {
function Node (line 1975) | static Node outNode(const GraphNode& n) {
function Edge (line 1982) | static Edge edge(const GraphNode& n) {
function Edge (line 1989) | static Edge edge(const GraphEdge& e) {
type True (line 1993) | typedef True NodeNumTag;
type True (line 1999) | typedef True EdgeNumTag;
function edgeNum (line 2001) | int edgeNum() const {
type typename (line 2027) | typedef typename Parent::template
function set (line 2042) | void set(const Node& key, const T& val) {
function typename (line 2047) | typename MapTraits<NodeImpl>::ReturnValue
function typename (line 2053) | typename MapTraits<NodeImpl>::ConstReturnValue
type typename (line 2065) | typedef typename Parent::template
type typename (line 2066) | typedef typename Parent::template
function set (line 2082) | void set(const Edge& key, const T& val) {
function typename (line 2090) | typename MapTraits<EdgeMapImpl>::ReturnValue
function typename (line 2099) | typename MapTraits<EdgeMapImpl>::ConstReturnValue
type _Graph (line 2123) | typedef _Graph Graph;
type typename (line 2125) | typedef typename Graph::Node GraphNode;
type typename (line 2126) | typedef typename Graph::Node GraphEdge;
type InvalidType (line 2135) | typedef InvalidType EdgeNotifier;
type _Graph (line 2148) | typedef _Graph Graph;
type typename (line 2150) | typedef typename Graph::Node GraphNode;
type typename (line 2151) | typedef typename Graph::Edge GraphEdge;
type typename (line 2153) | typedef typename Parent::Node Node;
type typename (line 2154) | typedef typename Parent::Edge Edge;
function setGraph (line 2161) | void setGraph(_Graph& graph) {
type AlterationNotifier (line 2172) | typedef AlterationNotifier<AlterableSplitGraphAdaptor, Node> NodeNotifier;
type InvalidType (line 2173) | typedef InvalidType EdgeNotifier;
type AlterableSplitGraphAdaptor (line 2183) | typedef AlterableSplitGraphAdaptor AdaptorBase;
function setNotifier (line 2195) | void setNotifier(typename Graph::NodeNotifier& graph_notifier) {
function virtual (line 2209) | virtual void add(const std::vector<GraphNode>& gn) {
function virtual (line 2218) | virtual void erase(const GraphNode& gn) {
function virtual (line 2225) | virtual void erase(const std::vector<GraphNode>& gn) {
function virtual (line 2233) | virtual void build() {
function virtual (line 2236) | virtual void clear() {
type _Graph (line 2259) | typedef _Graph Graph;
type typename (line 2261) | typedef typename Graph::Node GraphNode;
type typename (line 2262) | typedef typename Graph::Edge GraphEdge;
type typename (line 2264) | typedef typename Parent::Node Node;
type typename (line 2265) | typedef typename Parent::Edge Edge;
function setGraph (line 2273) | void setGraph(_Graph& g) {
type AlterationNotifier (line 2286) | typedef AlterationNotifier<AlterableSplitGraphAdaptor, Node> NodeNotifier;
type AlterationNotifier (line 2287) | typedef AlterationNotifier<AlterableSplitGraphAdaptor, Edge> EdgeNotifier;
type AlterableSplitGraphAdaptor (line 2298) | typedef AlterableSplitGraphAdaptor AdaptorBase;
function setNotifier (line 2310) | void setNotifier(typename Graph::NodeNotifier& graph_notifier) {
function virtual (line 2324) | virtual void add(const std::vector<GraphNode>& gn) {
function virtual (line 2335) | virtual void erase(const GraphNode& gn) {
function virtual (line 2342) | virtual void erase(const std::vector<GraphNode>& gn) {
function virtual (line 2353) | virtual void build() {
function virtual (line 2363) | virtual void clear() {
function class (line 2377) | class EdgeNotifierProxy : public Graph::EdgeNotifier::ObserverBase {
function setNotifier (line 2393) | void setNotifier(typename Graph::EdgeNotifier& graph_notifier) {
function virtual (line 2403) | virtual void add(const std::vector<GraphEdge>& ge) {
function virtual (line 2410) | virtual void erase(const GraphEdge& ge) {
function virtual (line 2413) | virtual void erase(const std::vector<GraphEdge>& ge) {
function virtual (line 2420) | virtual void build() {
function virtual (line 2429) | virtual void clear() {
type typename (line 2523) | typedef typename Parent::Node Node;
type typename (line 2524) | typedef typename Parent::Edge Edge;
type typename (line 2542) | typedef typename InNodeMap::Value Value;
function Value (line 2564) | Value operator[](const Key& key) const {
function set (line 2575) | void set(const Key& key, const Value& value) {
type typename (line 2628) | typedef typename GraphEdgeMap::Value Value;
function set (line 2639) | void set(const Edge& edge, const Value& val) {
function Value (line 2650) | Value operator[](const Key& edge) const {
FILE: src/lemon/graph_utils.h
function namespace (line 40) | namespace lemon {
function _map (line 645) | _map(map) {}
function virtual (line 647) | virtual void copy(const Graph& graph, const RefMap& refMap) {
function _cmap (line 663) | _cmap(cmap) {}
function virtual (line 665) | virtual void copy(const Graph& graph, const RefMap& refMap) {
type typename (line 776) | typedef typename From::NodeIt NodeIt;
type typename (line 777) | typedef typename From::Edge Edge;
type typename (line 778) | typedef typename From::EdgeIt EdgeIt;
type typename (line 780) | typedef typename To::Node TNode;
type typename (line 781) | typedef typename To::Edge TEdge;
type typename (line 783) | typedef typename From::template
type typename (line 784) | typedef typename From::template
function run (line 899) | void run() {
type typename (line 955) | typedef typename From::NodeIt NodeIt;
type typename (line 956) | typedef typename From::Edge Edge;
type typename (line 957) | typedef typename From::EdgeIt EdgeIt;
type typename (line 958) | typedef typename From::UEdge UEdge;
type typename (line 959) | typedef typename From::UEdgeIt UEdgeIt;
type typename (line 961) | typedef typename To::Node TNode;
type typename (line 962) | typedef typename To::Edge TEdge;
type typename (line 963) | typedef typename To::UEdge TUEdge;
type typename (line 965) | typedef typename From::template
type typename (line 966) | typedef typename From::template
type EdgeRefMap (line 968) | struct EdgeRefMap {
function run (line 1150) | void run() {
type typename (line 1214) | typedef typename From::ANode ANode;
type typename (line 1215) | typedef typename From::BNode BNode;
type typename (line 1216) | typedef typename From::NodeIt NodeIt;
type typename (line 1217) | typedef typename From::Edge Edge;
type typename (line 1218) | typedef typename From::EdgeIt EdgeIt;
type typename (line 1219) | typedef typename From::UEdge UEdge;
type typename (line 1220) | typedef typename From::UEdgeIt UEdgeIt;
type typename (line 1222) | typedef typename To::Node TNode;
type typename (line 1223) | typedef typename To::Edge TEdge;
type typename (line 1224) | typedef typename To::UEdge TUEdge;
type typename (line 1226) | typedef typename From::template
type typename (line 1227) | typedef typename From::template
type typename (line 1228) | typedef typename From::template
type NodeRefMap (line 1230) | struct NodeRefMap {
type EdgeRefMap (line 1247) | struct EdgeRefMap {
function run (line 1501) | void run() {
type Value (line 1589) | typedef int Value;
type _Item (line 1590) | typedef _Item Item;
type _Item (line 1591) | typedef _Item Key;
function explicit (line 1596) | explicit IdMap(const Graph& _graph) : graph(&_graph) {}
function const (line 1601) | int operator[](const Item& item) const { return graph->id(item);}
function Item (line 1606) | Item operator()(int id) { return graph->fromId(id, Item()); }
function explicit (line 1628) | explicit InverseMap(const IdMap& idMap) : graph(idMap.graph) {}
function Item (line 1634) | Item operator[](int id) const { return graph->fromId(id, Item());}
type _Graph (line 1668) | typedef _Graph Graph;
type std (line 1670) | typedef std::map<_Value, _Item> Container;
type typename (line 1678) | typedef typename Map::Value Value;
function explicit (line 1686) | explicit InvertableMap(const Graph& graph) : Map(graph) {}
function set (line 1744) | void set(const Key& key, const Value& val) {
function typename (line 1757) | typename MapTraits<Map>::ConstReturnValue
function Key (line 1765) | Key operator()(const Value& key) const {
function virtual (line 1789) | virtual void erase(const std::vector<Key>& keys) {
function virtual (line 1804) | virtual void clear() {
type typename (line 1824) | typedef typename InvertableMap::Key Value;
type typename (line 1826) | typedef typename InvertableMap::Value Key;
function Value (line 1832) | Value operator[](const Key& key) const {
type DefaultMap (line 1870) | typedef DefaultMap<_Graph, _Item, int> Map;
type typename (line 1877) | typedef typename Map::Key Key;
type typename (line 1879) | typedef typename Map::Value Value;
function explicit (line 1884) | explicit DescriptorMap(const Graph& _graph) : Map(_graph) {
function virtual (line 1909) | virtual void add(const std::vector<Item>& items) {
function virtual (line 1921) | virtual void erase(const Item& item) {
function virtual (line 1932) | virtual void erase(const std::vector<Item>& items) {
function virtual (line 1945) | virtual void build() {
function virtual (line 1959) | virtual void clear() {
function swap (line 1976) | void swap(const Item& p, const Item& q) {
function const (line 1988) | int operator[](const Item& item) const {
function Item (line 1995) | Item operator()(int id) const {
type typename (line 2018) | typedef typename DescriptorMap::Key Value;
type typename (line 2020) | typedef typename DescriptorMap::Value Key;
function Value (line 2026) | Value operator[](const Key& key) const {
function InverseMap (line 2044) | const InverseMap inverse() const {
function Value (line 2072) | Value operator[](const Key& edge) const {
type typename (line 2099) | typedef typename Graph::Edge Key;
function explicit (line 2105) | explicit TargetMap(const Graph& _graph) : graph(_graph) {}
function Value (line 2112) | Value operator[](const Key& e) const {
type typename (line 2139) | typedef typename Graph::UEdge Key;
function explicit (line 2145) | explicit ForwardMap(const Graph& _graph) : graph(_graph) {}
function Value (line 2152) | Value operator[](const Key& key) const {
type typename (line 2179) | typedef typename Graph::UEdge Key;
function explicit (line 2185) | explicit BackwardMap(const Graph& _graph) : graph(_graph) {}
function Value (line 2192) | Value operator[](const Key& key) const {
type typename (line 2218) | typedef typename NodeMap::Value Value;
function explicit (line 2223) | explicit PotentialDifferenceMap(const Graph& _graph,
function Value (line 2230) | Value operator[](const Key& edge) const {
type Value (line 2274) | typedef int Value;
type typename (line 2275) | typedef typename Graph::Node Key;
type typename (line 2277) | typedef typename ItemSetTraits<_Graph, typename
type typename (line 2286) | typedef typename Parent::Graph Graph;
function Parent (line 2288) | AutoNodeMap(const Graph& graph) : Parent(graph, 0) {}
function virtual (line 2290) | virtual void add(const Key& key) {
function virtual (line 2295) | virtual void add(const std::vector<Key>& keys) {
function virtual (line 2302) | virtual void build() {
function const (line 2326) | int operator[](const Key& key) const {
function virtual (line 2334) | virtual void add(const Edge& edge) {
function virtual (line 2338) | virtual void add(const std::vector<Edge>& edges) {
function virtual (line 2344) | virtual void erase(const Edge& edge) {
function virtual (line 2348) | virtual void erase(const std::vector<Edge>& edges) {
function virtual (line 2354) | virtual void build() {
function virtual (line 2360) | virtual void clear() {
type _Graph (line 2398) | typedef _Graph Graph;
type Value (line 2399) | typedef int Value;
type typename (line 2400) | typedef typename Graph::Node Key;
type typename (line 2408) | typedef typename Parent::Graph Graph;
function Parent (line 2410) | AutoNodeMap(const Graph& graph) : Parent(graph, 0) {}
function virtual (line 2412) | virtual void add(const Key& key) {
function virtual (line 2416) | virtual void add(const std::vector<Key>& keys) {
function virtual (line 2422) | virtual void build() {
function const (line 2446) | int operator[](const Key& key) const {
function virtual (line 2454) | virtual void add(const Edge& edge) {
function virtual (line 2458) | virtual void add(const std::vector<Edge>& edges) {
function virtual (line 2464) | virtual void erase(const Edge& edge) {
function virtual (line 2468) | virtual void erase(const std::vector<Edge>& edges) {
function virtual (line 2474) | virtual void build() {
function virtual (line 2480) | virtual void clear() {
type G (line 2524) | typedef G Graph;
function Parent (line 2533) | AutoNodeMap(const G& graph) : Parent(graph, INVALID) {}
function virtual (line 2535) | virtual void add(const Node& node) {
function virtual (line 2540) | virtual void add(const std::vector<Node>& nodes) {
function virtual (line 2547) | virtual void build() {
function class (line 2563) | class EdgeLess {
function virtual (line 2599) | virtual void erase(const Edge& edge) {
function virtual (line 2603) | virtual void erase(const std::vector<Edge>& edges) {
function virtual (line 2609) | virtual void build() {
function virtual (line 2613) | virtual void clear() {
function insert (line 2619) | void insert(Edge edge) {
function remove (line 2654) | void remove(Edge edge) {
function Edge (line 2723) | Edge refreshRec(std::vector<Edge> &v,int a,int b)
function refresh (line 2744) | void refresh() {
function zig (line 2758) | void zig(Edge v) {
function zag (line 2776) | void zag(Edge v) {
function splay (line 2794) | void splay(Edge v) {
function Edge (line 2870) | Edge findFirst(Node s, Node t) const
function Edge (line 2911) | Edge findNext(Node, Node t, Edge e) const
type G (line 2961) | typedef G Graph;
function class (line 2969) | class EdgeLess {
function refresh (line 3024) | void refresh()
function Edge (line 3043) | Edge operator()(Node s, Node t) const
type G (line 3078) | typedef G Graph;
function Edge (line 3082) | Edge refreshNext(Edge head,Edge next=INVALID)
function refreshNext (line 3094) | void refreshNext()
function refresh (line 3115) | void refresh(Node n)
function refresh (line 3130) | void refresh()
function Edge (line 3164) | Edge operator()(Node s, Node t, Edge prev=INVALID) const {}
function Edge (line 3167) | Edge operator()(Node s, Node t, Edge prev) const
FILE: src/lemon/list_graph.h
function namespace (line 34) | namespace lemon {
function Node (line 480) | Node split(Edge e) {
function class (line 498) | class Snapshot {
function class (line 725) | class ListUGraphBase {
type UGraphExtender (line 1098) | typedef UGraphExtender<ListUGraphBase> ExtendedListUGraphBase;
function class (line 1117) | class ListUGraph : public ExtendedListUGraphBase {
function class (line 1242) | class Snapshot {
function class (line 1467) | class ListBpUGraphBase {
type BpUGraphExtender (line 1854) | typedef BpUGraphExtender<BidirBpUGraphExtender<ListBpUGraphBase> >
function class (line 1869) | class ListBpUGraph : public ExtendedListBpUGraphBase {
FILE: src/lemon/maps.h
function namespace (line 35) | namespace lemon {
type typename (line 181) | typedef typename Parent::Key Key;
type typename (line 183) | typedef typename Parent::Value Value;
type T (line 185) | typedef T& Reference;
type T (line 187) | typedef const T& ConstReference;
type True (line 189) | typedef True ReferenceMapTag;
function ConstReference (line 228) | ConstReference operator[](const Key &k) const {
function set (line 237) | void set(const Key &k, const T &t) {
function setAll (line 246) | void setAll(const T &t) {
type rebind (line 252) | struct rebind {
type typename (line 299) | typedef typename Parent::Key Key;
type typename (line 301) | typedef typename Parent::Value Value;
type T (line 303) | typedef T& Reference;
type T (line 305) | typedef const T& ConstReference;
type True (line 307) | typedef True ReferenceMapTag;
function ConstReference (line 346) | ConstReference operator[](Key k) const {
function set (line 351) | void set(const Key &k, const T& t) {
type typename (line 379) | typedef typename Parent::Key Key;
type typename (line 380) | typedef typename Parent::Value Value;
function T (line 383) | const T& operator[](const T& t) const {
type typename (line 409) | typedef typename Parent::Key Key;
type typename (line 410) | typedef typename Parent::Value Value;
function m (line 416) | ConvertMap(const M &_m) : m(_m) {}
function Value (line 419) | Value operator[](const Key& k) const {return m[k];}
type typename (line 447) | typedef typename Parent::Key Key;
type typename (line 448) | typedef typename Parent::Value Value;
function m (line 451) | SimpleMap(const M &_m) : m(_m) {}
function Value (line 453) | Value operator[](Key k) const {return m[k];}
type typename (line 481) | typedef typename Parent::Key Key;
type typename (line 482) | typedef typename Parent::Value Value;
function m (line 485) | m(_m) {}
function Value (line 487) | Value operator[](Key k) const {return m[k];}
function set (line 489) | void set(Key k, const Value& c) { m.set(k, c); }
type typename (line 514) | typedef typename Parent::Key Key;
type typename (line 515) | typedef typename Parent::Value Value;
function Value (line 520) | Value operator[](Key k) const {return m1[k]+m2[k];}
type typename (line 557) | typedef typename Parent::Key Key;
type typename (line 558) | typedef typename Parent::Value Value;
function Value (line 567) | Value operator[](Key k) const {return m[k] + v;}
type typename (line 583) | typedef typename Parent::Key Key;
type typename (line 584) | typedef typename Parent::Value Value;
function Value (line 593) | Value operator[](Key k) const {return m[k] + v;}
function set (line 595) | void set(Key k, const Value& c) { m.set(k, c - v); }
type typename (line 629) | typedef typename Parent::Key Key;
type typename (line 630) | typedef typename Parent::Value Value;
function Value (line 635) | Value operator[](Key k) const {return m1[k]-m2[k];}
type typename (line 660) | typedef typename Parent::Key Key;
type typename (line 661) | typedef typename Parent::Value Value;
function Value (line 666) | Value operator[](Key k) const {return m1[k]*m2[k];}
type typename (line 701) | typedef typename Parent::Key Key;
type typename (line 702) | typedef typename Parent::Value Value;
function Value (line 711) | Value operator[](Key k) const {return v * m[k];}
type typename (line 729) | typedef typename Parent::Key Key;
type typename (line 730) | typedef typename Parent::Value Value;
function Value (line 739) | Value operator[](Key k) const {return v * m[k];}
function set (line 741) | void set(Key k, const Value& c) { m.set(k, c / v);}
type typename (line 774) | typedef typename Parent::Key Key;
type typename (line 775) | typedef typename Parent::Value Value;
function Value (line 780) | Value operator[](Key k) const {return m1[k]/m2[k];}
type typename (line 815) | typedef typename Parent::Key Key;
type typename (line 816) | typedef typename Parent::Value Value;
function typename (line 821) | typename MapTraits<M1>::ConstReturnValue
type typename (line 865) | typedef typename Parent::Key Key;
type typename (line 866) | typedef typename Parent::Value Value;
function Value (line 872) | Value operator[](Key k) const {return f(m1[k],m2[k]);}
type typename (line 923) | typedef typename Parent::Key Key;
type typename (line 924) | typedef typename Parent::Value Value;
function m (line 927) | NegMap(const M &_m) : m(_m) {}
function Value (line 929) | Value operator[](Key k) const {return -m[k];}
type typename (line 945) | typedef typename Parent::Key Key;
type typename (line 946) | typedef typename Parent::Value Value;
function m (line 949) | m(_m) {}
function Value (line 951) | Value operator[](Key k) const {return -m[k];}
function set (line 953) | void set(Key k, const Value& v) { m.set(k, -v); }
type typename (line 1000) | typedef typename Parent::Key Key;
type typename (line 1001) | typedef typename Parent::Value Value;
function m (line 1004) | AbsMap(const M &_m) : m(_m) {}
function Value (line 1006) | Value operator[](Key k) const {
type typename (line 1043) | typedef typename Parent::Key Key;
type typename (line 1044) | typedef typename Parent::Value Value;
function f (line 1047) | f(_f) {}
function Value (line 1049) | Value operator[](Key k) const { return f(k);}
type typename (line 1093) | typedef typename Parent::Key Key;
type typename (line 1094) | typedef typename Parent::Value Value;
type typename (line 1096) | typedef typename M::Key argument_type;
type typename (line 1097) | typedef typename M::Value result_type;
function m (line 1100) | MapFunctor(const M &_m) : m(_m) {}
function Value (line 1102) | Value operator()(Key k) const {return m[k];}
function Value (line 1104) | Value operator[](Key k) const {return m[k];}
type typename (line 1133) | typedef typename Parent::Key Key;
type typename (line 1134) | typedef typename Parent::Value Value;
function Value (line 1139) | Value operator[](Key k) const {return m1[k];}
type typename (line 1161) | typedef typename Parent::Key Key;
type typename (line 1162) | typedef typename Parent::Value Value;
function Value (line 1167) | Value operator[](Key k) const {return m1[k];}
function set (line 1169) | void set(Key k, const Value &v) {m1.set(k,v); m2.set(k,v);}
type typename (line 1206) | typedef typename Parent::Key Key;
type typename (line 1207) | typedef typename Parent::Value Value;
function m (line 1210) | NotMap(const M &_m) : m(_m) {}
function Value (line 1212) | Value operator[](Key k) const {return !m[k];}
type typename (line 1228) | typedef typename Parent::Key Key;
type typename (line 1229) | typedef typename Parent::Value Value;
function m (line 1232) | m(_m) {}
function Value (line 1234) | Value operator[](Key k) const {return !m[k];}
function set (line 1236) | void set(Key k, bool v) { m.set(k, !v); }
function namespace (line 1257) | namespace _maps_bits {
type typename (line 1318) | typedef typename _Functor::argument_type Key;
type Value (line 1319) | typedef bool Value;
type _Functor (line 1321) | typedef _Functor Functor;
function set (line 1338) | void set(const Key& key, Value value) const {
type Value (line 1374) | typedef bool Value;
function set (line 1382) | void set(const Key& key, Value value) {
type Value (line 1409) | typedef bool Value;
function set (line 1417) | void set(const Key& key, Value value) {
type Value (line 1452) | typedef bool Value;
function set (line 1474) | void set(const Key& key, Value value) {
type Value (line 1516) | typedef bool Value;
function typename (line 1532) | typename Map::Value& fillValue() {
function fillValue (line 1537) | void fillValue(const typename Map::Value& _fill) {
function set (line 1542) | void set(const Key& key, Value value) {
type Value (line 1607) | typedef bool Value;
function set (line 1619) | void set(const Key& key, Value value) {
FILE: src/lemon/math.h
function namespace (line 32) | namespace lemon {
FILE: src/lemon/smart_graph.h
function namespace (line 38) | namespace lemon {
type GraphExtender (line 186) | typedef GraphExtender<SmartGraphBase> ExtendedSmartGraphBase;
function class (line 204) | class SmartGraph : public ExtendedSmartGraphBase {
function save (line 369) | void save(SmartGraph &_g)
function restore (line 383) | void restore()
function class (line 391) | class SmartUGraphBase {
type UGraphExtender (line 589) | typedef UGraphExtender<SmartUGraphBase> ExtendedSmartUGraphBase;
function class (line 608) | class SmartUGraph : public ExtendedSmartUGraphBase {
function class (line 760) | class SmartBpUGraphBase {
function class (line 804) | class UEdge {
function firstANode (line 818) | void firstANode(Node& node) const {
function nextANode (line 822) | void nextANode(Node& node) const {
function firstBNode (line 827) | void firstBNode(Node& node) const {
function nextBNode (line 830) | void nextBNode(Node& node) const {
function first (line 834) | void first(Node& node) const {
function next (line 841) | void next(Node& node) const {
function first (line 848) | void first(UEdge& edge) const {
function next (line 851) | void next(UEdge& edge) const {
function firstFromANode (line 855) | void firstFromANode(UEdge& edge, const Node& node) const {
function nextFromANode (line 859) | void nextFromANode(UEdge& edge) const {
function firstFromBNode (line 863) | void firstFromBNode(UEdge& edge, const Node& node) const {
function nextFromBNode (line 867) | void nextFromBNode(UEdge& edge) const {
function id (line 871) | static int id(const Node& node) {
function Node (line 874) | static Node nodeFromId(int id) {
function id (line 882) | static int id(const UEdge& edge) {
function UEdge (line 885) | static UEdge uEdgeFromId(int id) {
function aNodeId (line 892) | static int aNodeId(const Node& node) {
function Node (line 895) | static Node nodeFromANodeId(int id) {
function bNodeId (line 902) | static int bNodeId(const Node& node) {
function Node (line 905) | static Node nodeFromBNodeId(int id) {
function Node (line 912) | Node aNode(const UEdge& edge) const {
function Node (line 915) | Node bNode(const UEdge& edge) const {
function aNode (line 919) | static bool aNode(const Node& node) {
function bNode (line 923) | static bool bNode(const Node& node) {
function Node (line 927) | Node addANode() {
function Node (line 934) | Node addBNode() {
function UEdge (line 941) | UEdge addEdge(const Node& source, const Node& target) {
function reserveANode (line 959) | void reserveANode(int n) { aNodes.reserve(n); }
function reserveBNode (line 960) | void reserveBNode(int n) { bNodes.reserve(n); }
function reserveEdge (line 962) | void reserveEdge(int m) { edges.reserve(m); }
function clear (line 964) | void clear() {
type True (line 970) | typedef True NodeNumTag;
type True (line 975) | typedef True EdgeNumTag;
type BpUGraphExtender (line 981) | typedef BpUGraphExtender<BidirBpUGraphExtender<SmartBpUGraphBase> >
function class (line 1000) | class SmartBpUGraph : public ExtendedSmartBpUGraphBase {
FILE: src/lemon/tolerance.h
function namespace (line 30) | namespace lemon {
FILE: src/lemon/topology.h
function namespace (line 44) | namespace lemon {
FILE: src/locfit/adap.c
function acri (line 17) | double acri(lk,t0,t2,pen)
function mmse (line 26) | double mmse(lf,des)
function INT (line 55) | INT ainitband(des,lf)
function aband2 (line 101) | double aband2(des,lf,h0)
function aband3 (line 152) | double aband3(des,lf,h0)
FILE: src/locfit/ar_funs.c
function vrexp (line 14) | double vrexp() { return(rexp(1.0)); }
function vrnorm (line 15) | double vrnorm() { return(rnorm(0.0,1.0)); }
function vpnorm (line 16) | double vpnorm(double x){ return(pnorm(x,0.0,1.0)); }
function vdnorm (line 17) | double vdnorm(double x){ return(exp(-x*x/2)/S2PI); }
function dummyf (line 18) | double dummyf() { return(0.0); }
function frac (line 19) | double frac(double x) { return(x-floor(x)); }
function vmin (line 21) | double vmin(v)
function vmax (line 33) | double vmax(v)
function vsum (line 45) | double vsum(v)
function vmean (line 53) | double vmean(vari *v) { return(vsum(v)/vlength(v)); }
function ar_setfunction (line 55) | int ar_setfunction(rt,z,len)
FILE: src/locfit/arith.c
function vadd (line 14) | double vadd(double e1,double e2) { return(e1+e2); }
function vsub (line 15) | double vsub(double e1,double e2) { return(e1-e2); }
function vmul (line 16) | double vmul(double e1,double e2) { return(e1*e2); }
function vdiv (line 17) | double vdiv(double e1,double e2) { return(e1/e2); }
function vpow (line 18) | double vpow(double e1,double e2)
function vgt (line 23) | double vgt(double e1,double e2) { return((double)(e1>e2)); }
function vlt (line 24) | double vlt(double e1,double e2) { return((double)(e1<e2)); }
function vge (line 25) | double vge(double e1,double e2) { return((double)(e1>=e2)); }
function vle (line 26) | double vle(double e1,double e2) { return((double)(e1<=e2)); }
function veq (line 27) | double veq(double e1,double e2) { return((double)(e1==e2)); }
function vne (line 28) | double vne(double e1,double e2) { return((double)(e1!=e2)); }
function lf_exp (line 32) | double lf_exp(double x) { return (x<700.0) ? exp(x) : exp(700.0); }
function vseq (line 34) | double vseq(double a,double b,int i,int n) { return(a+(b-a)*i/(n-1)); }
function rsample (line 36) | double rsample(v)
function setnext (line 74) | void setnext(va,n,p,k)
function prars (line 86) | void prars(v,i)
function isstring (line 100) | int isstring(z,i1,i2)
function isname (line 109) | int isname(z,i1,i2)
function isfunction (line 119) | int isfunction(z,i1,i2)
function issubset (line 129) | int issubset(z,i1,i2)
function isNumber (line 139) | int isNumber(z,i1,i2,val)
function isoperator (line 148) | int isoperator(z,i1,i2)
function dareval (line 553) | double dareval(v,k,x)
function darith (line 578) | double darith(z)
function INT (line 588) | INT arvect(z,res,c,a) /* c = no of items to read */
FILE: src/locfit/band.c
function INT (line 18) | INT procvbind(des,lf,v)
function bcri (line 38) | double bcri(h,c,cri)
function bsel2 (line 66) | void bsel2(h0,g0,ifact,c,cri)
function bsel3 (line 89) | void bsel3(h0,g0,ifact,c,cri)
function bselect (line 103) | void bselect(c,cri,pn)
function compsda (line 133) | double compsda(x,h,n)
function widthsj (line 151) | double widthsj(x,lambda,n)
function kdecri (line 177) | void kdecri(x,h,res,c,k,ker,n)
function esolve (line 282) | double esolve(x,j,h0,h1,k,c,ker,n)
function kdeselect (line 328) | void kdeselect(band,x,ind,h0,h1,meth,nm,ker,n)
function band (line 342) | void band(v)
function slscv (line 374) | void slscv(x,n,h,z)
FILE: src/locfit/c_args.c
function getarg (line 16) | int getarg(v,s,un) /* un=1: unnamed permitted un=2: next unused */
function readilist (line 55) | int readilist(ivec,z,n0,n1,pad)
function getlogic (line 79) | int getlogic(v,i)
FILE: src/locfit/c_plot.c
function plotopt (line 77) | void plotopt(v,re)
function pvari (line 139) | void pvari(cmd,xyz,win,ax)
function plotdata (line 166) | void plotdata(v)
function plotfit (line 224) | void plotfit(v)
function plottrack (line 391) | void plottrack(v)
function setplot (line 436) | void setplot(v)
FILE: src/locfit/cmd.c
type lfcol (line 26) | struct lfcol
function savefit (line 44) | void savefit(v,mode)
function readdata (line 60) | void readdata(v)
function savedata (line 71) | void savedata(v)
function recondat (line 80) | void recondat(xonly,n)
function ckap (line 99) | void ckap(v)
function crband (line 117) | void crband(v)
function ckdeb (line 132) | void ckdeb(v)
function docrit (line 168) | double docrit(v)
function crit (line 178) | void crit(v)
function backtr (line 187) | double backtr(th,mi,nd)
function predict (line 194) | void predict(vc)
function printfit (line 282) | void printfit(v)
function knots (line 343) | void knots(v)
function summfit (line 376) | void summfit(v)
function AC (line 415) | void AC(name,r,g,b,p)
function INT (line 422) | INT getcolidx(cname, def)
function greyscale (line 433) | void greyscale(v)
function setcolor (line 444) | void setcolor(v)
function table (line 478) | void table(v)
function setout (line 555) | void setout(v)
function dosleep (line 580) | void dosleep(v)
function setdef (line 589) | void setdef(v)
function dcmdint (line 614) | void dcmdint(v)
function cmdint (line 672) | void cmdint(v)
function INT (line 736) | INT locfit_dispatch(char *z)
function setuplf (line 752) | void setuplf()
FILE: src/locfit/dens_haz.c
function INT (line 33) | INT haz_sph_int(lf,dfx,cf,h,r1)
function INT (line 68) | INT hazint_sph(t,resp,r1,lf,cf,h)
function INT (line 96) | INT hazint_prod(t,resp,x,lf,cf,h)
function INT (line 172) | INT hazint(t,resp,resp1,lf,cf,h)
function haz_init (line 181) | void haz_init(lf,des,il)
FILE: src/locfit/dens_int.c
function lforder (line 29) | void lforder(ind,x,l,r)
function estdiv (line 61) | double estdiv(x0,x1,f0,f1,d0,d1,link)
function dens_integrate (line 104) | double dens_integrate(lf,des,z)
function dens_renorm (line 185) | void dens_renorm(lf,des)
function dens_lscv (line 196) | void dens_lscv(des,lf)
FILE: src/locfit/dens_odi.c
function INT (line 23) | INT exbctay(b,c,n,z) /* n-term taylor series of e^(bx+cx^2) */
function explinjtay (line 43) | double explinjtay(l0,l1,j,cf)
function explint1 (line 60) | void explint1(l0,l1,cf,I,p) /* int x^j exp(a+bx); j=0..p-1 */
function explintyl (line 92) | void explintyl(l0,l1,cf,I,p) /* small c, use taylor series and explint1 */
function solvetrid (line 103) | void solvetrid(X,y,m)
function initi0i1 (line 121) | void initi0i1(I,cf,y0,y1,l0,l1)
function explinsid (line 142) | void explinsid(l0,l1,cf,I,p) /* large b; don't use fwd recursion */
function explinbkr (line 192) | void explinbkr(l0,l1,cf,I,p) /* small b,c; use back recursion */
function explinfbk0 (line 209) | void explinfbk0(l0,l1,cf,I,p) /* fwd and bac recur; b=0; c<0 */
function explinfbk (line 260) | void explinfbk(l0,l1,cf,I,p) /* fwd and bac recur; b not too large */
function recent (line 291) | void recent(I,resp,wt,p,s,x)
function recurint (line 307) | void recurint(l0,l2,cf,resp,p,ker)
function INT (line 418) | INT onedexpl(cf,mi,resp)
function INT (line 436) | INT onedgaus(cf,mi,resp)
function INT (line 463) | INT onedint(cf,mi,l0,l1,resp) /* int W(u)u^j exp(..), j=0..2*deg */
FILE: src/locfit/density.c
function prresp (line 16) | void prresp(coef,resp,p)
function INT (line 30) | INT multint(t,resp1,resp2,lf,cf,h)
function INT (line 75) | INT mlinint(t,resp1,resp2,lf,cf,h)
function prodint_resp (line 165) | void prodint_resp(resp,prod_wk,dim,deg,p)
function INT (line 197) | INT prodint(t,resp,resp2,lf,coef,h)
function INT (line 241) | INT gausint(t,resp,C,cf,h,mi,sca)
function likeden (line 293) | int likeden(coef, lk0, f1, A)
function INT (line 343) | INT inre(x,bound,d)
function INT (line 354) | INT setintlimits(lf, x, h, ang, lset)
function INT (line 386) | INT selectintmeth(mi,lset,ang)
function INT (line 437) | INT densinit(lf,des,h,cf,m)
FILE: src/locfit/design.h
type design (line 9) | typedef struct {
FILE: src/locfit/dist.c
function dchisq (line 14) | double dchisq(x, df)
function df (line 19) | double df(x, df1, df2)
function ibeta (line 27) | double ibeta(x, a, b)
function igamma (line 77) | double igamma(x, df)
function pf (line 137) | double pf(q, df1, df2)
function pchisq (line 142) | double pchisq(q, df)
function pnorm (line 149) | double pnorm(x,mu,s)
function pnorm (line 154) | double pnorm(x,mu,s)
FILE: src/locfit/ev_atree.c
function atree_guessnv (line 16) | void atree_guessnv(nvm,ncm,vc,dp,mi)
function INT (line 56) | INT atree_split(lf,ce,le,ll,ur)
function atree_grow (line 87) | void atree_grow(des,lf,ce,ct,term,ll,ur)
function atree_start (line 132) | void atree_start(des,lf)
function atree_int (line 167) | double atree_int(tr,x,what)
FILE: src/locfit/ev_interp.c
function linear_interp (line 8) | double linear_interp(h,d,f0,f1)
function hermite2 (line 14) | void hermite2(x,z,phi)
function cubic_interp (line 38) | double cubic_interp(h,f0,f1,d0,d1)
function cubintd (line 45) | double cubintd(h,f0,f1,d0,d1)
function rectcell_interp (line 65) | double rectcell_interp(x,xev,vv,ll,ur,d,nc)
function INT (line 115) | INT exvval(lf,vv,nv,d,what,z)
function exvvalpv (line 162) | void exvvalpv(vv,vl,vr,d,k,dl,nc)
function gridint (line 181) | double gridint(tr,x,what)
function fitpint (line 212) | double fitpint(lf,x,what,i)
function dointpointpf (line 221) | double dointpointpf(lf,des,x,what)
function xbarint (line 233) | double xbarint(lf,x,what)
function dointpoint (line 247) | double dointpoint(lf,des,x,what,ev,j)
FILE: src/locfit/ev_kdtre.c
function kdtre_guessnv (line 16) | void kdtre_guessnv(nvm,ncm,vc,dp,mi)
function ksmall (line 50) | int ksmall(l, r, m, x, pi)
function INT (line 101) | INT terminal(tr,p,pi,fc,d,m,split_val)
function kdtre_start (line 141) | void kdtre_start(des,tr)
function newcell (line 226) | void newcell(nv,vc,xev, d, k, split_val, cpar, clef, crig)
function blend (line 254) | double blend(lf,s,x,ll,ur,j,nt,t,what)
function kdtre_int (line 305) | double kdtre_int(lf,x,what)
FILE: src/locfit/ev_main.c
function guessnv (line 33) | void guessnv(nvm,ncm,vc,dp,mi)
function lfit_reqd (line 71) | int lfit_reqd(d,nvm,ncm)
function lfit_reqi (line 75) | int lfit_reqi(nvm,ncm,vc)
function trchck (line 80) | void trchck(tr,nvm,ncm,d,p,vc)
function reassign (line 115) | void reassign(lf)
function dataf (line 149) | void dataf(des,lf)
function xbarf (line 167) | void xbarf(des,lf)
function preset (line 181) | void preset(des,lf)
function crossf (line 199) | void crossf(des,lf)
function gridf (line 218) | void gridf(des,tr)
function INT (line 248) | INT newsplit(des,lf,i0,i1,pv)
FILE: src/locfit/ev_trian.c
function INT (line 8) | INT triang_split(tr,ce,le)
function resort (line 26) | void resort(pv,xev,dig)
function triang_grow (line 54) | void triang_grow(des,tr,ce,ct,term)
function triang_descend (line 105) | void triang_descend(tr,xa,ce)
function covrofdata (line 179) | void covrofdata(lf,V,mn) /* covar of data; mean in mn */
function INT (line 195) | INT intri(x,w,xev,xa,d) /* is x in triangle bounded by xd[0..d-1]? */
function triang_start (line 213) | void triang_start(des,tr) /* Triangulation with polyhedral start */
function triang_cubicint (line 277) | double triang_cubicint(v,vv,w,d,nc,xxa)
function triang_clotoch (line 317) | double triang_clotoch(xev,vv,ce,p,xxa)
function INT (line 401) | INT triang_getvertexvals(lf,vv,i,what)
function triang_int (line 428) | double triang_int(tr,x,what)
FILE: src/locfit/family.c
function INT (line 12) | INT defaultlink(link,family)
function INT (line 50) | INT validlinks(link,family)
function INT (line 79) | INT famdens(mean,th,link,res,cens,w)
function INT (line 91) | INT famgaus(y,mean,th,link,res,cens,w)
function INT (line 133) | INT famrobu(y,mean,th,link,res,cens,w,rs)
function INT (line 159) | INT famcauc(y,p,th,link,res,cens,w,rs)
function INT (line 174) | INT famrbin(y,p,th,link,res,cens,w)
function INT (line 200) | INT fambino(y,p,th,link,res,cens,w)
function INT (line 259) | INT fampois(y,mean,th,link,res,cens,w)
function INT (line 330) | INT famgamm(y,mean,th,link,res,cens,w)
function INT (line 389) | INT famgeom(y,mean,th,link,res,cens,w)
function INT (line 430) | INT famweib(y,mean,th,link,res,cens,w)
function INT (line 451) | INT famcirc(y,mean,th,link,res,cens,w)
function robustify (line 465) | void robustify(res,rs)
function lf_link (line 476) | double lf_link(y,lin)
function invlink (line 491) | double invlink(th,lin)
function INT (line 507) | INT links(th,y,fam,lin,res,cd,w,rs) /* the link and various related func...
function INT (line 552) | INT stdlinks(res,lf,i,th,rs)
function b2 (line 564) | double b2(th,tg,w)
function b3 (line 579) | double b3(th,tg,w)
function b4 (line 594) | double b4(th,tg,w)
FILE: src/locfit/fitted.c
function resid (line 20) | double resid(y,w,th,mi,ty,res)
function studentize (line 52) | double studentize(res,inl,var,ty,link)
function fitted (line 74) | void fitted(lf,des,fit,what,cv,st,ty)
function cfitted (line 128) | void cfitted(v,ty)
FILE: src/locfit/frend.c
function resp (line 11) | double resp(lf,i)
function prwt (line 18) | double prwt(lf,i)
function base (line 26) | double base(lf,i)
function cens (line 33) | double cens(lf,i)
function vocri (line 40) | double vocri(lk,t0,t2,pen)
function INT (line 46) | INT procvraw(des,lf,v)
function set_default_like (line 91) | void set_default_like(lf,nvm,v,d)
function INT (line 102) | INT procv(des,lf,v)
function intvo (line 180) | double intvo(des,lf,c0,c1,a,p,t0,t20,t21)
function INT (line 197) | INT procvvord(des,lf,v)
function ressummd (line 264) | void ressummd(lf,des)
function ressumm (line 284) | void ressumm(lf,des)
function rss (line 393) | double rss(lf,des,df)
FILE: src/locfit/help.c
function example (line 18) | void example(v)
FILE: src/locfit/imatlb.h
type vari (line 1) | typedef struct {
type xtwxstruc (line 6) | typedef struct {
type paramcomp (line 10) | typedef struct {
type design (line 15) | typedef struct {
type lfit (line 23) | typedef struct {
FILE: src/locfit/lf_dercor.c
function dercor (line 21) | void dercor(des,lf,coef)
FILE: src/locfit/lf_fitfun.c
function INT (line 25) | INT calcp(mi,deg)
function INT (line 44) | INT coefnumber(deriv,nd,kt,d,deg)
function makecfn (line 70) | void makecfn(des,lf)
function fitfunangl (line 94) | void fitfunangl(dx,ff,sca,cd,deg)
function fitfun (line 120) | void fitfun(lf,x,t,f,deriv,nd)
function designmatrix (line 234) | void designmatrix(lf,des)
FILE: src/locfit/lf_robust.c
function median (line 36) | double median(x,n)
function nrobustscale (line 65) | double nrobustscale(lf,des,rs)
function robustscale (line 89) | double robustscale(lf,des)
function update_rs (line 106) | double update_rs(x)
function lf_robust (line 117) | void lf_robust(lf,des)
FILE: src/locfit/lf_vari.c
function vmat (line 21) | void vmat(lf, des, M12, M2, tr)
function comp_infl (line 75) | double comp_infl(lf,des)
function comp_vari (line 83) | void comp_vari(lf,des,tr,t0)
function local_df (line 123) | void local_df(lf,des,tr)
FILE: src/locfit/lfd.c
function closefile (line 18) | void closefile()
function openfile (line 23) | void openfile(mode)
function INT (line 40) | INT setfilename(name,ext,mode,fp)
function readchar (line 108) | void readchar(c,n)
function readstr (line 114) | void readstr(z)
function dumpchar (line 123) | void dumpchar(c,n)
function dumpstr (line 129) | void dumpstr(z)
function dosavedata (line 136) | void dosavedata(v,fp)
function doreaddata (line 178) | void doreaddata(name,fp)
function dosavefit (line 233) | void dosavefit(lf,fi,mode,fp)
FILE: src/locfit/lfstr.c
function INT (line 35) | INT lffamily(z)
function getlffam (line 55) | void getlffam(z,x)
function setstrval (line 88) | void setstrval(mi,v,z)
function INT (line 134) | INT restyp(z)
function INT (line 143) | INT ppwhat(z)
FILE: src/locfit/lfstruc.h
type vari (line 19) | typedef struct {
type vari (line 28) | typedef struct {
type carg (line 39) | typedef struct {
type device (line 44) | typedef struct {
type paramcomp (line 50) | typedef struct {
type lfit (line 55) | typedef struct {
type pplot (line 72) | typedef struct {
type arstruct (line 77) | typedef struct {
type plxyz (line 83) | typedef struct {
type plots (line 88) | typedef struct {
type lfcol (line 99) | struct lfcol {
FILE: src/locfit/linalg.c
function svd (line 8) | void svd(x,p,q,d,mxit) /* svd of square matrix */
function INT (line 83) | INT svdsolve(x,w,P,D,Q,d,tol) /* original X = PDQ^T; comp. QD^{-1}P^T x */
function hsvdsolve (line 110) | void hsvdsolve(x,w,P,D,Q,d,tol) /* original X = PDQ^T; comp. D^{-1/2}P^T...
function QRupd (line 128) | void QRupd(X,u,p,w,y)
function QR1 (line 152) | void QR1(X,n,p,w) /* QR of X (n*p); take w for the ride, if not NULL */
function bacK (line 196) | void bacK(R,f,p) /* R^{-1} f */
function bacT (line 207) | void bacT(R,f,p,i0,i1) /* R^{-1} (R^T)^{-1} f; p columns; use i0-(i1-1...
function solve (line 225) | void solve(A,b,d) /* this is crude! A organized by column. */
function grsc (line 244) | void grsc(X,d)
function setzero (line 262) | void setzero(v,p)
function unitvec (line 269) | void unitvec(x,k,p)
function innerprod (line 276) | double innerprod(v1,v2,p)
function addouter (line 286) | void addouter(re,v1,v2,p,c)
function multmatscal (line 295) | void multmatscal(A,z,n)
function transpose (line 309) | void transpose(x,m,n)
function m_trace (line 328) | double m_trace(x,n)
FILE: src/locfit/local.h
type INT (line 77) | typedef int INT;
FILE: src/locfit/locfit.c
function likereg (line 16) | int likereg(coef, lk0, f1, Z)
function INT (line 79) | INT robustinit(lf,des)
function INT (line 91) | INT circinit(lf,des)
function INT (line 108) | INT reginit(lf,des)
function lfinit (line 165) | int lfinit(lf,des)
function lfiter (line 195) | void lfiter(lf,des)
function use_robust_scale (line 213) | int use_robust_scale(int tg)
function locfit (line 219) | int locfit(lf,des,h,noit)
FILE: src/locfit/m_chol.c
function chol_dec (line 9) | void chol_dec(A,n)
function chol_solve (line 31) | int chol_solve(A,v,p)
function chol_hsolve (line 47) | int chol_hsolve(A,v,p)
function chol_qf (line 59) | double chol_qf(A,v,p)
FILE: src/locfit/m_eigen.c
function e_tol (line 12) | double e_tol(D,p)
function eig_dec (line 23) | void eig_dec(X,P,d)
function eig_solve (line 66) | int eig_solve(J,x)
function eig_hsolve (line 97) | int eig_hsolve(J,v)
function eig_qf (line 124) | double eig_qf(J,v)
FILE: src/locfit/m_jacob.c
function jac_reqd (line 13) | int jac_reqd(int p) { return(2*p*(p+1)); }
function jacob_dec (line 28) | void jacob_dec(J, meth)
function jacob_solve (line 57) | int jacob_solve(J,v) /* (X^T W X)^{-1} v */
function jacob_hsolve (line 79) | int jacob_hsolve(J,v) /* J^{-1/2} v */
function jacob_qf (line 99) | double jacob_qf(J,v) /* vT J^{-1} v */
FILE: src/locfit/m_max.c
function max_grid (line 41) | double max_grid(f,xlo,xhi,n,flag)
function max_golden (line 63) | double max_golden(f,xlo,xhi,n,tol,err,flag)
function max_quad (line 104) | double max_quad(f,xlo,xhi,n,tol,err,flag)
function max_nr (line 169) | double max_nr(F, coef, old_coef, f1, delta, J, p, maxit, tol, err)
FILE: src/locfit/makecmd.c
type forvar (line 34) | typedef struct {
function countfields (line 42) | int countfields(z)
function makefields (line 66) | void makefields(z, va, n)
function set_forvar (line 116) | void set_forvar(v,ct)
function inc_forvar (line 135) | void inc_forvar()
function dec_forvar (line 154) | void dec_forvar()
function run (line 162) | void run(va)
function makecmd (line 188) | void makecmd(cmdline)
function del_lines (line 221) | void del_lines()
function vari (line 233) | vari *getcmd()
FILE: src/locfit/math.c
function lferf (line 25) | double lferf(x)
function lferfc (line 51) | double lferfc(x)
function lflgamma (line 58) | double lflgamma(x)
function lfdaws (line 80) | double lfdaws(x)
function ptail (line 125) | double ptail(x) /* exp(x*x/2)*int_{-\infty}^x exp(-u^2/2)du for x < -6 */
function logit (line 139) | double logit(x)
function expit (line 144) | double expit(x)
function factorial (line 154) | int factorial(n)
FILE: src/locfit/minmax.c
function ipower (line 22) | double ipower(x,n) /* use for n not too large!! */
function setmmwt (line 30) | double setmmwt(des,lf,a,gam)
function mmsums (line 51) | int mmsums(coef,f,z,J)
function updatesd (line 84) | double updatesd(des,lf,z,p,a,a0,sw0,gam)
function mm_initial (line 140) | int mm_initial(des,lf,z,p,coef)
function mmax (line 159) | int mmax(coef, old_coef, f1, delta, J, p, maxit, tol, err)
function findab (line 223) | double findab(double gam)
function weightmm (line 249) | double weightmm(coef,di,ff,mi,gam)
function minmax (line 259) | double minmax(lf,des)
FILE: src/locfit/mutil.h
type jacobian (line 12) | typedef struct {
FILE: src/locfit/nbhd.c
function rho (line 15) | double rho(x,sc,d,kt,sty) /* ||x|| for appropriate distance metric */
function kordstat (line 51) | double kordstat(x,k,n,ind)
function INT (line 78) | INT inlim(lf,xlim,i,d)
function compbandwid (line 91) | double compbandwid(di,ind,x,n,d,nn,fxh)
function nbhd1 (line 117) | double nbhd1(lf,des,k,fxh)
function nbhd (line 184) | double nbhd(lf,des,nn,fxh,redo)
FILE: src/locfit/pcomp.c
function INT (line 12) | INT noparcomp(lf)
function INT (line 25) | INT hasparcomp(lf)
function pc_reqd (line 31) | int pc_reqd(d,p)
function pcchk (line 37) | void pcchk(pc,d,p,lc)
function compparcomp (line 55) | void compparcomp(des,lf,nopc)
function subparcomp (line 128) | void subparcomp(des,lf,coef)
function subparcomp2 (line 149) | void subparcomp2(des,lf,vr,il)
function addparcomp (line 178) | double addparcomp(lf,x,c)
FILE: src/locfit/pout.c
function FILE (line 24) | FILE *popen(const char *cmd,const char *mode) { return(NULL); }
function pclose (line 25) | int pclose(FILE *file) { return(0); }
function f2 (line 30) | char f2(fmt)
function INT (line 39) | INT pretty(xl,k,z)
function isgrid (line 61) | void isgrid(xyz)
function getxyzitem (line 93) | void getxyzitem(x,xyz,i)
function project (line 107) | void project(z,x,theta,phi)
function iproject (line 117) | void iproject(z,i,theta,phi)
function line3d (line 125) | void line3d(z1,z2,theta,phi,dev,col)
function xyztext (line 136) | void xyztext(tx,x,ah,av,theta,phi,dev,col)
function getgreylevel (line 147) | int getgreylevel(z)
function points3d (line 156) | void points3d(x,theta,phi,dev,type)
function lines3d (line 175) | void lines3d(xyz,theta,phi,dev)
function segments (line 194) | void segments(xyz0,xyz1,theta,phi,dev)
function spl (line 209) | double spl(z0,z1)
function contour3d (line 215) | void contour3d(x,theta,phi,dev,sl,nsl)
function angle (line 303) | double angle(x0,x1,x2) /* rotation angle from (x0,x1) to (x0,x2) */
function persp3d (line 318) | void persp3d(xyz,theta,phi,DP,sl,nsl)
function updatelim (line 376) | void updatelim(v,xl)
function axis (line 389) | void axis(z1,z2,zl,lab,theta,phi,a,s,dev)
function plotxwin (line 442) | void plotxwin(pl,dev,wn,w,h,rd)
function plotmaple (line 553) | void plotmaple(pl)
function plotmathe (line 593) | void plotmathe(pl,fmt)
function plotmatlb (line 645) | void plotmatlb(pl) /* Matlab */
function plotgnup (line 687) | void plotgnup(pl,fmt)
FILE: src/locfit/preplot.c
function predptall (line 32) | void predptall(lf,des,x,what,ev,i)
function prepvector (line 57) | void prepvector(lf,des,x,n,what) /* interpolate a vector */
function prepfitp (line 71) | void prepfitp(lf,des,what)
function prepgrid (line 84) | void prepgrid(lf,des,x,mg,n,what) /* interpolate a grid given margins */
function preplot (line 103) | void preplot(lf,des,x,f,se,band,mg,where,what)
function cpreplot (line 153) | void cpreplot(pp,vc,band)
function INT (line 169) | INT setpppoints(pp,where,mg,xl)
FILE: src/locfit/random.c
function runif (line 15) | double runif()
function rseed (line 26) | void rseed(seed)
function rnorm (line 49) | double rnorm(mu,s)
function rexp (line 62) | double rexp(lb)
function rpois (line 74) | double rpois(lambda)
FILE: src/locfit/readfile.c
function readfile (line 25) | void readfile(vc)
FILE: src/locfit/scb.c
function covar_par (line 13) | double covar_par(lf,des,x1,x2)
function cumulant (line 57) | void cumulant(lf,des,sd)
function q2 (line 130) | double q2(u)
function p2 (line 136) | double p2(u)
function procvscb2 (line 143) | void procvscb2(des,lf,v)
function scb (line 194) | void scb(des,lf)
function scbsim_fun (line 238) | double scbsim_fun(x)
function do_scbsim (line 273) | void do_scbsim(des,lf)
function scbsim (line 287) | void scbsim(lf,des)
function cscbsim (line 300) | void cscbsim(v)
FILE: src/locfit/scb_cons.c
function assignk0 (line 15) | void assignk0(z,d,n) /* z should be n*(2*d*d+2*d+2); */
function christ (line 23) | void christ(d,nn,nl) /* lij[i][j] = res proj. of Tij to (T1...Td) */
function d1 (line 45) | void d1(n,d) /* d1[i][j] = e_i^T (A^T A)^{-1} B_j^T */
function k2x (line 61) | void k2x(lf,des,kap)
function l1x (line 91) | void l1x(lf,des,lap,re)
function m0x (line 137) | void m0x(lf,des,m0,re,rg)
function INT (line 159) | INT constants(des,lf,kap)
function tailp (line 270) | double tailp(c,k0,m,d,nu)
function taild (line 289) | double taild(c,k0,m,d,nu)
function critval (line 308) | double critval(k0,m,d,al,it,s,nu)
function scritval (line 336) | void scritval(k0,d,cov,m,rdf,z)
FILE: src/locfit/simul.c
function goldensec (line 10) | void goldensec(f,des,tr,eps,xm,ym,meth)
function dnk (line 53) | double dnk(x,k)
function locai (line 70) | double locai(h,des,tr)
function loccp (line 82) | double loccp(h,des,tr,m) /* m=1: cp m=2: gcv */
function cp (line 102) | double cp(des,tr,meth)
function gkk (line 111) | double gkk(des,tr)
function rsw (line 138) | double rsw(des,tr,kk)
function rband (line 186) | void rband(des,tr,hhat,meth,nmeth,kk)
FILE: src/locfit/solve.c
function solve_secant (line 47) | double solve_secant(f,c,xlo,xhi,tol,bd_flag,err)
function solve_nr (line 96) | double solve_nr(f,f1,c,x0,tol,err)
function solve_fp (line 107) | double solve_fp(f,x0,tol,maxit)
FILE: src/locfit/startlf.c
function fitdefault (line 25) | void fitdefault(lf,n,d)
function des_reqd (line 61) | int des_reqd(n,p)
function des_reqi (line 66) | int des_reqi(INT n) { return(n); }
function deschk (line 68) | void deschk(des,n,p)
function bbox (line 120) | void bbox(lf,bx)
function preproc (line 148) | void preproc(des,lf,nopc)
function startlf (line 185) | void startlf(des,lf,vfun,nopc)
function INT (line 239) | INT nofit()
function endfit (line 244) | void endfit()
function INT (line 253) | INT drl(key,dv,mi)
function fitoptions (line 266) | void fitoptions(lf,vc,re)
function clocfit (line 417) | void clocfit(v,re)
FILE: src/locfit/strings.c
function stm (line 36) | int stm(char *u, char *v, int k) { return((strncmp(u,v,k)==0)); }
function ct_match (line 38) | int ct_match(z1, z2)
function pmatch (line 48) | int pmatch(z, strings, vals, n, def)
function matchrt (line 64) | int matchrt(z,i,i2,op,cl)
function matchlf (line 85) | int matchlf(z,i1,i,op,cl)
function checkltor (line 106) | int checkltor(z,i1,i2,c)
function checkrtol (line 122) | int checkrtol(z,i1,i2,c)
function strip (line 137) | void strip(z)
FILE: src/locfit/vari.cpp
function cleardb (line 34) | void cleardb()
function initdb (line 47) | void initdb() /* initialize locfit's work space */
function INT (line 76) | INT vbytes(int n, int mode)
function vitem (line 103) | double vitem(vari* v, int i)
function vassn (line 126) | void vassn(vari* v, int i, double x)
function vari (line 131) | vari *growvar(vari* vold, int n)
function setvarname (line 169) | void setvarname(vari* v, varname name)
function vari (line 183) | vari *findvar(varname name, int err, int* n)
function deletevar (line 219) | void deletevar(vari* v) /* delete variable, or top variable if NULL */
function deleteifhidden (line 239) | void deleteifhidden(vari* v)
function deletename (line 246) | void deletename(varname name) /* delete variable name, or top variable i...
function vari (line 254) | vari *createvar(varname name, int status, int n, int mode)
FILE: src/locfit/wdiag.c
function nnresproj (line 21) | void nnresproj(lf,des,u,m,p,mi)
function wdexpand (line 38) | void wdexpand(l,n,ind,m)
function INT (line 59) | INT wdiagp(lf,des,lx,deg,ty,exp)
function INT (line 98) | INT wdiag(lf,des,lx,deg,ty,exp)
function INT (line 224) | INT procvhatm(des,lf,v)
function cwdiag (line 241) | void cwdiag(v)
FILE: src/locfit/weight.c
function W (line 14) | double W(u,ker)
function INT (line 43) | INT iscompact(ker)
function weightprod (line 49) | double weightprod(lf,u,h)
function weightsph (line 80) | double weightsph(lf,u,h,hasdi,di)
function weight (line 97) | double weight(lf,x,t,h,hasdi,di)
function sgn (line 112) | double sgn(x)
function WdW (line 119) | double WdW(u,ker) /* W'(u)/W(u) */
function weightd (line 143) | double weightd(u,sc,d,ker,kt,h,sty,di)
function weightdd (line 159) | double weightdd(u,sc,d,ker,kt,h,sty,di,i0,i1)
function Wd (line 174) | double Wd(u,ker)
function Wdd (line 195) | double Wdd(u,ker)
function wint (line 217) | double wint(d,j,nj,ker)
function INT (line 258) | INT wtaylor(f,x,ker)
function Wconv (line 331) | double Wconv(v,ker)
function Wconv1 (line 359) | double Wconv1(v,ker)
function Wconv4 (line 384) | double Wconv4(v,ker)
function Wconv5 (line 400) | double Wconv5(v,ker) /* (d/dv)^5 int W(x)W(x+v)dx */
function Wconv6 (line 416) | double Wconv6(v,ker)
function Wikk (line 435) | double Wikk(ker,deg)
FILE: src/matching_merge.cpp
function find_path (line 15) | void find_path(const DAG& bundle_dag,
function extend_chains_to_paths (line 49) | void extend_chains_to_paths(const DAG& bundle_dag,
function make_scaffolds_from_paths (line 78) | void make_scaffolds_from_paths(DAG& bundle_dag,
FILE: src/matching_merge.h
type lemon (line 24) | typedef lemon::SmartBpUGraph ReachGraph;
FILE: src/multireads.cpp
function MultiHit (line 19) | MultiHit* MultiRead::get_hit(RefID r_id, int left, int right)
function MultiRead (line 61) | MultiRead* MultiReadTable::get_read(InsertID mr_id)
FILE: src/multireads.h
type RefID (line 6) | typedef uint64_t RefID;
type InsertID (line 7) | typedef uint64_t InsertID;
type MultiHit (line 9) | struct MultiHit
function class (line 22) | class MultiRead
function num_hits (line 41) | size_t num_hits() { return (int)_hits.size(); }
function class (line 49) | class MultiReadTable
FILE: src/negative_binomial_distribution.h
type RealType (line 40) | typedef RealType input_type;
function class (line 42) | class param_type {
function param (line 151) | void param(const param_type& parm)
function reset (line 161) | void reset() { }
FILE: src/progressbar.h
function class (line 11) | class ProgressBar
function update (line 49) | void update(const char* bundle_label_buf, double inc_amt)
function remaining (line 75) | void remaining(int num_remaining)
function complete (line 97) | void complete()
FILE: src/replicates.cpp
function transform_counts_to_common_scale (line 297) | void transform_counts_to_common_scale(const vector<double>& scale_factors,
function calc_geometric_scaling_factors (line 312) | void calc_geometric_scaling_factors(const vector<LocusCountList>& sample...
function calc_classic_fpkm_scaling_factors (line 354) | void calc_classic_fpkm_scaling_factors(const vector<LocusCountList>& sam...
function calc_quartile_scaling_factors (line 392) | void calc_quartile_scaling_factors(const vector<LocusCountList>& sample_...
function calc_tmm_scaling_factors (line 445) | void calc_tmm_scaling_factors(const vector<LocusCountList>& sample_compa...
type SCVInterpolator (line 453) | struct SCVInterpolator
method add_scv_pair (line 455) | void add_scv_pair(double est_scv, double true_scv)
method finalize (line 461) | void finalize()
method interpolate_scv (line 473) | double interpolate_scv(double est_scv)
function build_scv_correction_fit (line 587) | void build_scv_correction_fit(int nreps, int ngenes, int mean_count, SCV...
function calculate_count_means_and_vars (line 729) | void calculate_count_means_and_vars(const vector<LocusCountList>& sample...
function fit_dispersion_model_helper (line 757) | boost::shared_ptr<MassDispersionModel>
function fit_dispersion_model (line 886) | boost::shared_ptr<MassDispersionModel>
function build_norm_table (line 926) | void build_norm_table(const vector<LocusCountList>& full_count_table,
function normalize_counts (line 980) | void normalize_counts(vector<boost::shared_ptr<ReadGroupProperties> > & ...
FILE: src/replicates.h
function class (line 15) | class MassDispersionModel
function class (line 79) | class PoissonDispersionModel : public MassDispersionModel
function class (line 95) | class MleErrorModel
type LocusCountList (line 117) | struct LocusCountList
function class (line 153) | class ReplicatedBundleFactory
function set_mask_rnas (line 456) | void set_mask_rnas(const vector<boost::shared_ptr<Scaffold> >& mRNAs)
function mass_dispersion_model (line 469) | void mass_dispersion_model(boost::shared_ptr<MassDispersionModel const> ...
function mle_error_model (line 485) | void mle_error_model(boost::shared_ptr<MleErrorModel const> mle_model)
FILE: src/rounding.h
function namespace (line 57) | namespace rounding
FILE: src/sampling.cpp
function generate_importance_samples (line 14) | void generate_importance_samples(multinormal_generator<double>& generator,
FILE: src/sampling.h
function namespace (line 44) | namespace boost { namespace numeric { namespace ublas {
type permutation_matrix (line 169) | typedef permutation_matrix<std::size_t> pmatrix;
type boost (line 206) | typedef boost::mt19937 base_generator_type;
type boost (line 207) | typedef boost::normal_distribution<> distribution_type;
function boost (line 225) | const boost::numeric::ublas::vector<ValueType>& next_rand()
function set_parameters (line 251) | void set_parameters(const boost::numeric::ublas::vector<ValueType>& mean,
FILE: src/scaffold_graph.cpp
type HitBufBasket (line 24) | struct HitBufBasket
method HitBufBasket (line 26) | HitBufBasket(int coord, Scaffold* h, DAGNode d)
function right_lt (line 35) | bool right_lt (const HitBufBasket& lhs,
type Expired (line 41) | struct Expired
method Expired (line 43) | Expired(int ec) : expiration_coord(ec) {}
type ConnectState (line 52) | enum ConnectState { UNKNOWN, CONNECT, DONT_CONNECT }
type connect_visitor (line 55) | struct connect_visitor
method connect_visitor (line 59) | connect_visitor(CompatibilityMap compatibility, ConnectMap connect, DA...
function record_connections (line 98) | connect_visitor<CompatibilityMap, ConnectMap, Tag>
function create_overlap_dag (line 108) | bool create_overlap_dag(vector<Scaffold>& hits,
function add_terminal_nodes (line 246) | pair<DAGNode, DAGNode> add_terminal_nodes(DAG& bundle_dag)
FILE: src/scaffold_graph.h
type boost (line 27) | typedef boost::adjacency_list<boost::vecS,
type boost (line 32) | typedef boost::graph_traits<DAG>::vertex_descriptor DAGNode;
type boost (line 34) | typedef boost::property_map<DAG, boost::vertex_name_t>::type HitsForNode...
FILE: src/scaffolds.cpp
function disjoint_ops (line 93) | void disjoint_ops(vector<AugmentedCuffOp>& to_reduce)
function record_gaps (line 120) | void record_gaps(const vector<AugmentedCuffOp>& to_fill,
function is_known (line 424) | bool is_known(const AugmentedCuffOp& op)
function check_merge_length (line 431) | bool check_merge_length(const vector<AugmentedCuffOp>& ops)
function has_intron (line 455) | inline bool has_intron(const Scaffold& scaff)
function BOOST_FOREACH (line 822) | BOOST_FOREACH (const Scaffold& sc, s)
function BOOST_FOREACH (line 877) | BOOST_FOREACH(const AugmentedCuffOp& op, orig_ops)
function BOOST_FOREACH (line 894) | BOOST_FOREACH (const AugmentedCuffOp& op, padded_filler)
function intron_op (line 962) | bool intron_op(const AugmentedCuffOp& op)
function overlap_in_genome (line 1102) | bool overlap_in_genome(int ll, int lr, int rl, int rr)
function BOOST_FOREACH (line 1676) | BOOST_FOREACH(const MateHit* h, mate_hits())
function BOOST_FOREACH (line 1700) | BOOST_FOREACH (const MateHit* h, mate_hits())
function BOOST_FOREACH (line 1710) | BOOST_FOREACH (boost::shared_ptr<Scaffold const> ref_scaff, *ref_scaffs)
function BOOST_FOREACH (line 1735) | BOOST_FOREACH(const MateHit* h, _mates_in_scaff)
function BOOST_FOREACH (line 1746) | BOOST_FOREACH (AugmentedCuffOp a, _augmented_ops)
function BOOST_FOREACH (line 1757) | BOOST_FOREACH(const AugmentedCuffOp& a, hit_introns)
function BOOST_FOREACH (line 1763) | BOOST_FOREACH(const AugmentedCuffOp& a, scaffold_introns)
function BOOST_FOREACH (line 1776) | BOOST_FOREACH (AugmentedCuffOp a, _augmented_ops)
function scaff_lt (line 1787) | bool scaff_lt(const Scaffold& lhs, const Scaffold& rhs)
function scaff_lt_rt (line 1792) | bool scaff_lt_rt(const Scaffold& lhs, const Scaffold& rhs)
function scaff_lt_rt_oplt (line 1799) | bool scaff_lt_rt_oplt(const Scaffold& lhs, const Scaffold& rhs)
function scaff_lt_sp (line 1824) | bool scaff_lt_sp(boost::shared_ptr<Scaffold> lhs, boost::shared_ptr<Scaf...
function scaff_lt_rt_sp (line 1829) | bool scaff_lt_rt_sp(boost::shared_ptr<Scaffold> lhs, boost::shared_ptr<S...
function scaff_lt_rt_oplt_sp (line 1834) | bool scaff_lt_rt_oplt_sp(boost::shared_ptr<Scaffold> lhs, boost::shared_...
FILE: src/scaffolds.h
type CuffOpCode (line 26) | enum CuffOpCode { CUFF_MATCH, CUFF_INTRON, CUFF_UNKNOWN }
function g_left (line 28) | struct AugmentedCuffOp
function g_right (line 46) | void g_right(int right)
function overlap_in_genome (line 52) | static bool overlap_in_genome(const AugmentedCuffOp& lhs,
function contains (line 66) | bool contains(const AugmentedCuffOp& other) const
function properly_contains (line 73) | bool properly_contains(const AugmentedCuffOp& other) const
function match_length (line 81) | static int match_length(const AugmentedCuffOp& op, int left, int right)
function class (line 159) | class Scaffold
function vector (line 349) | const vector<const MateHit*>& mate_hits() const { return _mates_in_scaff; }
function annotated_trans_id (line 355) | void annotated_trans_id(const string& ann_name) { _annotated_trans_id = ...
function annotated_gene_id (line 358) | void annotated_gene_id(const string& ann_name) { _annotated_gene_id = an...
function annotated_gene_name (line 361) | void annotated_gene_name(const string& ann_name) { _annotated_gene_name ...
function annotated_protein_id (line 364) | void annotated_protein_id(const string& ann_name) { _annotated_protein_i...
function annotated_tss_id (line 367) | void annotated_tss_id(const string& ann_name) { _annotated_tss_id = ann_...
function nearest_ref_id (line 370) | void nearest_ref_id(const string& ann_name) { _nearest_ref_id = ann_name; }
function fpkm (line 375) | void fpkm(double fpkm) { _fpkm = fpkm; }
function num_fragments (line 378) | void num_fragments(double nf) { _num_fragments = nf; }
function seq (line 381) | void seq(const string& s) { _seq = s; }
function
Condensed preview — 235 files, each showing path, character count, and a content snippet. Download the .json file or copy for the full structured content (5,746K chars).
[
{
"path": ".gitignore",
"chars": 230,
"preview": "*.o\nMakefile\nMakefile.in\naclocal.m4\nautom4te.cache\nbuild-aux\nconfig.h\nconfig.h.in\nconfig.log\nconfig.status\nconfigure\n.de"
},
{
"path": "AUTHORS",
"chars": 795,
"preview": "Cufflinks authors\nPrimary contact <cole@cs.umd.edu>\n\nCole Trapnell designed and wrote Cufflinks and Cuffdiff, with subst"
},
{
"path": "LICENSE",
"chars": 1516,
"preview": "Copyright (C) 2003-2009 Cole Trapnell et al\n\n==========================================================================="
},
{
"path": "Makefile.am",
"chars": 115,
"preview": "\nALWAYS_BUILT = src\nSUBDIRS = $(ALWAYS_BUILT)\nDIST_SUBDIRS = $(ALWAYS_BUILT) \n\nEXTRA_DIST = LICENSE\n\n.PHONY: FORCE\n"
},
{
"path": "README.md",
"chars": 12052,
"preview": "\n# Cufflinks\n\nThe main *website* for cufflinks is [here](http://cole-trapnell-lab.github.io/cufflinks/)\n\n*NOTE*: If you'"
},
{
"path": "autogen.sh",
"chars": 382,
"preview": "#!/bin/sh\n\nsubmodule_init ( ) {\n local SUBMODULES=$(git submodule | awk '{print $2}')\n for submodule in $SUBMODULE"
},
{
"path": "ax_bam.m4",
"chars": 4412,
"preview": "# SYNOPSIS\n#\n# AX_BAM\n#\n# DESCRIPTION\n#\n# Test for the BAM libraries (htslib or bamlib)\n#\n# If no path to the inst"
},
{
"path": "ax_boost_base.m4",
"chars": 13716,
"preview": "# ===========================================================================\n# https://www.gnu.org/software/autoco"
},
{
"path": "ax_boost_filesystem.m4",
"chars": 4383,
"preview": "# ===========================================================================\n# https://www.gnu.org/software/autoconf-"
},
{
"path": "ax_boost_serialization.m4",
"chars": 4848,
"preview": "# ===========================================================================\n# https://www.gnu.org/software/autoconf-a"
},
{
"path": "ax_boost_system.m4",
"chars": 4182,
"preview": "# ===========================================================================\n# https://www.gnu.org/software/autocon"
},
{
"path": "ax_boost_thread.m4",
"chars": 5769,
"preview": "# ===========================================================================\n# https://www.gnu.org/software/autocon"
},
{
"path": "ax_check_eigen.m4",
"chars": 2348,
"preview": "# SYNOPSIS\n#\n# AX_EIGEN\n#\n# DESCRIPTION\n#\n# Test for the EIGEN libraries of a particular version (or newer)\n#\n# If"
},
{
"path": "ax_check_zlib.m4",
"chars": 4572,
"preview": "# ===========================================================================\n# http://www.gnu.org/software/autoco"
},
{
"path": "ax_openmp.m4",
"chars": 3473,
"preview": " # AC_C_OPENMP\n # -----------\n # Check which options need to be passed to the C compiler to support OpenMP.\n # Set the O"
},
{
"path": "boost.m4",
"chars": 2252,
"preview": "dnl AC_PATH_BOOST([MINIMUM-VERSION], [ACTION-IF-FOUND], [ACTION-IF-NOT-FOUND])\ndnl Test for the Boost C++ libraries of a"
},
{
"path": "configure.ac",
"chars": 4599,
"preview": "m4_include([ax_boost_base.m4])\nm4_include([ax_boost_thread.m4])\nm4_include([ax_boost_system.m4])\nm4_include([ax_boost_se"
},
{
"path": "cufflinks.xcodeproj/cole.pbxuser",
"chars": 66304,
"preview": "// !$*UTF8*$!\n{\n\t08FB7793FE84155DC02AAC07 /* Project object */ = {\n\t\tactiveArchitecturePreference = x86_64;\n\t\tactiveBuil"
},
{
"path": "cufflinks.xcodeproj/cole.perspectivev3",
"chars": 45737,
"preview": "<?xml version=\"1.0\" encoding=\"UTF-8\"?>\n<!DOCTYPE plist PUBLIC \"-//Apple//DTD PLIST 1.0//EN\" \"http://www.apple.com/DTDs/P"
},
{
"path": "cufflinks.xcodeproj/project.pbxproj",
"chars": 195452,
"preview": "// !$*UTF8*$!\n{\n\tarchiveVersion = 1;\n\tclasses = {\n\t};\n\tobjectVersion = 46;\n\tobjects = {\n\n/* Begin PBXBuildFile section *"
},
{
"path": "doc/CL_supplement.tex",
"chars": 90644,
"preview": "\\documentclass[12pt]{amsart}\r\n\r\n\\usepackage{graphicx}\r\n\\usepackage{amsmath}\r\n\\usepackage[pdftex]{hyperref}\r\n\r\n\\setlength"
},
{
"path": "doc/CL_versions.tex",
"chars": 63853,
"preview": "\\documentclass[12pt]{amsart}\r\n\r\n\\usepackage{graphicx}\r\n\\usepackage{amsmath}\r\n\\usepackage[pdftex]{hyperref}\r\n\r\n\\setlength"
},
{
"path": "doc/algorithm/algorithm.bib",
"chars": 1182,
"preview": "%% This BibTeX bibliography file in UTF-8 format was created using Papers.\n%% http://mekentosj.com/papers/\n\n@article{Eri"
},
{
"path": "doc/algorithm/algorithm.tex",
"chars": 17200,
"preview": "%\n% Cufflinks algorithm\n%\n% Created by Cole Trapnell on 2009-03-11.\n% Copyright (c) 2009 Cole Trapnell. All rights re"
},
{
"path": "doc/algorithm/homework.cls",
"chars": 1861,
"preview": "% homework.sty \n% For formatting homework \n% --- Class structure: identification part \n% --- \n\\ProvidesClass{homework}["
},
{
"path": "doc/cufflinks.bib",
"chars": 221842,
"preview": "%% This BibTeX bibliography file was created using BibDesk.\r\n%% http://bibdesk.sourceforge.net/\r\n\r\n\r\n%% Created for Coli"
},
{
"path": "doc/html/css/style.css",
"chars": 6375,
"preview": "/* \nStylesheet for the free sNews15_1 template\nfrom http://www.free-css-templates.com\n*/\n\n/* Reset all margins and paddi"
},
{
"path": "doc/html/downloads/test_data.sam",
"chars": 41526,
"preview": "test_mRNA_3_187_51\t99\ttest_chromosome\t53\t255\t75M\t=\t163\t0\tTACTATTTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACG"
},
{
"path": "doc/html/faq.html",
"chars": 27202,
"preview": "<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Strict//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd\">\n<html xmln"
},
{
"path": "doc/html/gff.html",
"chars": 21627,
"preview": "<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Strict//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd\">\n<html xmln"
},
{
"path": "doc/html/howitworks.html",
"chars": 32140,
"preview": "<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Strict//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd\">\n<html xmln"
},
{
"path": "doc/html/igenome/igenome_table.py",
"chars": 4923,
"preview": "#!/usr/bin/env python\n\nimport sys, os\nimport string\nfrom ftplib import FTP\n\nuse_message = '''\n'''\n\nftp_address = 'ftp.il"
},
{
"path": "doc/html/igenomes.html",
"chars": 24595,
"preview": "<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Strict//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd\">\n<html xmln"
},
{
"path": "doc/html/index.html",
"chars": 61893,
"preview": "<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Strict//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd\">\r\n<html xml"
},
{
"path": "doc/html/manual.html",
"chars": 132378,
"preview": "<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Strict//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd\">\n<html xmln"
},
{
"path": "doc/html/site.tmproj",
"chars": 3788,
"preview": "<?xml version=\"1.0\" encoding=\"UTF-8\"?>\n<!DOCTYPE plist PUBLIC \"-//Apple//DTD PLIST 1.0//EN\" \"http://www.apple.com/DTDs/P"
},
{
"path": "doc/html/tutorial.html",
"chars": 34123,
"preview": "<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Strict//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd\">\r\n<html xml"
},
{
"path": "doc/illustrator/Fig 2 - Tuxedo Workflow.ai",
"chars": 603097,
"preview": "%PDF-1.5\r%\r\n1 0 obj\r<</Metadata 2 0 R/OCProperties<</D<</ON[7 0 R]/Order 8 0 R/RBGroups[]>>/OCGs[7 0 R]>>/Pages 3 0 R/Ty"
},
{
"path": "external_tests/tiny_tests/2x75/accepted_hits.sam",
"chars": 31134,
"preview": "@HD\tVN:1.5\tSO:coordinate\n@SQ\tSN:test_chromosome\tLN:650\ntest_mRNA_3_187_51\t99\ttest_chromosome\t53\t255\t75M\t=\t163\t0\tTACTATTT"
},
{
"path": "external_tests/tiny_tests/2x75/test_ref.fa",
"chars": 680,
"preview": ">test_chromosome\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nACTACTATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCC\nA"
},
{
"path": "index.md",
"chars": 1656,
"preview": "---\nlayout: page\npermalink: /\ntags: [cufflinks, RNA-Seq]\nmodified: 2013-09-13\n---\n\nCufflinks assembles transcripts, esti"
},
{
"path": "make_bin.sh",
"chars": 1503,
"preview": "#!/bin/bash\n#simple script to pack up a precompiled binary package, with the boost thread\n# library statically linked in"
},
{
"path": "src/GArgs.cpp",
"chars": 10627,
"preview": "#include \"GBase.h\"\n#include \"GArgs.h\"\n#include <ctype.h>\n\nGArgs::GArgs(int argc, char* const argv[], const char* format,"
},
{
"path": "src/GArgs.h",
"chars": 4038,
"preview": "/*\nGArgs is a quick'n'dirty object oriented replacement for the standard \n getopts library available on many unix plat"
},
{
"path": "src/GBase.cpp",
"chars": 20384,
"preview": "#include \"GBase.h\"\n#include <stdarg.h>\n#include <ctype.h>\n\n#ifndef S_ISDIR\n#define S_ISDIR(mode) (((mode) & S_IFMT) == "
},
{
"path": "src/GBase.h",
"chars": 13614,
"preview": "#ifndef G_BASE_DEFINED\n#define G_BASE_DEFINED\n#ifndef _POSIX_SOURCE\n//mostly for MinGW\n#define _POSIX_SOURCE\n#endif\n#ifd"
},
{
"path": "src/GFaSeqGet.cpp",
"chars": 10226,
"preview": "#include \"GFaSeqGet.h\"\n#include \"gdna.h\"\n#include <ctype.h>\n\nvoid GSubSeq::setup(uint sstart, int slen, int sovl, int qf"
},
{
"path": "src/GFaSeqGet.h",
"chars": 4094,
"preview": "#ifndef GFASEQGET_H\n#define GFASEQGET_H\n#include \"GList.hh\"\n\n#define MAX_FASUBSEQ 0x20000000\n//max 512MB sequence data h"
},
{
"path": "src/GFastaIndex.cpp",
"chars": 5813,
"preview": "/*\n * GFastaIndex.cpp\n *\n * Created on: Aug 25, 2010\n * Author: gpertea\n */\n\n#include \"GFastaIndex.h\"\n#define ERR_"
},
{
"path": "src/GFastaIndex.h",
"chars": 2011,
"preview": "/*\n * GFaIdx.h\n *\n * Created on: Aug 25, 2010\n * Author: gpertea\n */\n\n#ifndef GFAIDX_H_\n#define GFAIDX_H_\n\n#includ"
},
{
"path": "src/GHash.hh",
"chars": 16871,
"preview": "/********************************************************************************\n* Hash table class te"
},
{
"path": "src/GList.hh",
"chars": 20988,
"preview": "//---------------------------------------------------------------------------\n/*\nSortable collections of objects and obj"
},
{
"path": "src/GStr.cpp",
"chars": 34936,
"preview": "//---------------------------------------------------------------------------\n#include \"GStr.h\"\n#include <stdio.h>\n#incl"
},
{
"path": "src/GStr.h",
"chars": 9069,
"preview": "//---------------------------------------------------------------------------\n#ifndef GSTR_H\n#define GSTR_H\n//----------"
},
{
"path": "src/GVec.hh",
"chars": 26804,
"preview": "//---------------------------------------------------------------------------\n/*\nSortable collection of pointers to obje"
},
{
"path": "src/LICENSE",
"chars": 626,
"preview": "\n==================================================================\n LICENSE\n===================="
},
{
"path": "src/Makefile.am",
"chars": 6195,
"preview": "#include $(top_srcdir)/build-aux/cufflinks.mk\n\nAM_CPPFLAGS = -I$(top_srcdir)/src \n\nEXTRA_DIST = \\\n $(top_srcdir)/AUTH"
},
{
"path": "src/abundances.cpp",
"chars": 167136,
"preview": "/*\n * abundances.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 4/27/09.\n * Copyright 2009 Cole Trapnell. All ri"
},
{
"path": "src/abundances.h",
"chars": 29685,
"preview": "#ifndef ABUNDANCES_H\n#define ABUNDANCES_H\n/*\n * abundances.h\n * cufflinks\n *\n * Created by Cole Trapnell on 4/27/09.\n"
},
{
"path": "src/assemble.cpp",
"chars": 15731,
"preview": "/*\n * assemble.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 3/23/09.\n * Copyright 2009 Cole Trapnell. All righ"
},
{
"path": "src/assemble.h",
"chars": 875,
"preview": "#ifndef ASSEMBLE_H\n#define ASSEMBLE_H\n\n/*\n * assemble.h\n * cufflinks\n *\n * Created by Cole Trapnell on 3/23/09.\n * C"
},
{
"path": "src/biascorrection.cpp",
"chars": 23340,
"preview": "/*\n * biascorrection.cpp\n * cufflinks\n *\n * Created by Adam Roberts on 5/20/10.\n * Copyright 2010 Adam Roberts. All "
},
{
"path": "src/biascorrection.h",
"chars": 3344,
"preview": "#ifndef BIASCORRECTION_H\n#define BIASCORRECTION_H\n\n/*\n * biascorrection.h\n * cufflinks\n *\n * Created by Adam Roberts "
},
{
"path": "src/bundles.cpp",
"chars": 61473,
"preview": "/*\n * bundles.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 9/6/09.\n * Copyright 2009 Cole Trapnell. All rights"
},
{
"path": "src/bundles.h",
"chars": 14603,
"preview": "#ifndef BUNDLES_H\n#define BUNDLES_H\n/*\n * bundles.h\n * cufflinks\n *\n * Created by Cole Trapnell on 9/6/09.\n * Copyri"
},
{
"path": "src/clustering.cpp",
"chars": 3058,
"preview": "/*\n * clustering.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 3/15/10.\n * Copyright 2010 Cole Trapnell. All ri"
},
{
"path": "src/clustering.h",
"chars": 4826,
"preview": "#ifndef CLUSTERING_H\n#define CLUSTERING_H\n/*\n * abundances.h\n * cufflinks\n *\n * Created by Cole Trapnell on 4/27/09.\n"
},
{
"path": "src/codons.cpp",
"chars": 4582,
"preview": "#include \"codons.h\"\n\nstatic char codonTable[32768]; //32K table for fasta codon decoding\n // codons are encoded as"
},
{
"path": "src/codons.h",
"chars": 1065,
"preview": "#ifndef CODONS_H\n#define CODONS_H\n#include \"GBase.h\"\n#include <ctype.h>\n\nunsigned short packCodon(char n1, char n2, char"
},
{
"path": "src/common.cpp",
"chars": 12799,
"preview": "/*\n * common.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 3/23/09.\n * Copyright 2008 Cole Trapnell. All rights"
},
{
"path": "src/common.h",
"chars": 25120,
"preview": "#ifndef COMMON_H\n#define COMMON_H\n/*\n * common.h\n * Cufflinks\n *\n * Created by Cole Trapnell on 11/26/08.\n * Copyrig"
},
{
"path": "src/compress_gtf.cpp",
"chars": 13110,
"preview": "/*\n * gtf_to_sam.cpp\n * Cufflinks\n *\n * Created by Cole Trapnell on 8/1/10.\n * Copyright 2009 Cole Trapnell. All rig"
},
{
"path": "src/cuffcluster.cpp",
"chars": 28583,
"preview": "/*\n * sorting_hat.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 8/30/10.\n * Copyright 2010 Cole Trapnell. All r"
},
{
"path": "src/cuffcompare.cpp",
"chars": 98769,
"preview": "#ifdef HAVE_CONFIG_H\n#include <config.h>\n#else\n#define PACKAGE_VERSION \"INTERNAL\"\n#define SVN_REVISION \"SVN\"\n#endif\n\n#in"
},
{
"path": "src/cuffdiff.cpp",
"chars": 98216,
"preview": "/*\n * cuffdiff.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 10/21/09.\n * Copyright 2009 Cole Trapnell. All rig"
},
{
"path": "src/cuffdiff_to_gct.py",
"chars": 3287,
"preview": "#!/usr/bin/env python2\n# encoding: utf-8\n\"\"\"\ncuffdiff_to_gct.py\n\nCreated by Cole Trapnell on 2010-08-30.\nCopyright (c) 2"
},
{
"path": "src/cufflinks.cpp",
"chars": 59017,
"preview": "/*\n * cufflinks.cpp\n * Cufflinks\n *\n * Created by Cole Trapnell on 3/23/09.\n * Copyright 2009 Cole Trapnell. All rig"
},
{
"path": "src/cufflinks.xcodeproj/cole.pbxuser",
"chars": 50201,
"preview": "// !$*UTF8*$!\n{\n\t08FB7793FE84155DC02AAC07 /* Project object */ = {\n\t\tactiveBuildConfigurationName = Debug;\n\t\tactiveExecu"
},
{
"path": "src/cufflinks.xcodeproj/cole.perspectivev3",
"chars": 45938,
"preview": "<?xml version=\"1.0\" encoding=\"UTF-8\"?>\n<!DOCTYPE plist PUBLIC \"-//Apple//DTD PLIST 1.0//EN\" \"http://www.apple.com/DTDs/P"
},
{
"path": "src/cufflinks.xcodeproj/project.pbxproj",
"chars": 21810,
"preview": "// !$*UTF8*$!\n{\n\tarchiveVersion = 1;\n\tclasses = {\n\t};\n\tobjectVersion = 45;\n\tobjects = {\n\n/* Begin PBXFileReference secti"
},
{
"path": "src/cuffmerge",
"chars": 19114,
"preview": "#!/usr/bin/env python2\n# encoding: utf-8\n\"\"\"\ncuffmerge.py\n\nCreated by Cole Trapnell on 2011-03-17.\nCopyright (c) 2011 Co"
},
{
"path": "src/cuffnorm.cpp",
"chars": 42156,
"preview": "/*\n * cuffdiff.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 10/21/09.\n * Copyright 2009 Cole Trapnell. All rig"
},
{
"path": "src/cuffquant.cpp",
"chars": 52084,
"preview": "/*\n * cuffdiff.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 10/21/09.\n * Copyright 2009 Cole Trapnell. All rig"
},
{
"path": "src/differential.cpp",
"chars": 63256,
"preview": "/*\n * differential.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 3/15/10.\n * Copyright 2010 Cole Trapnell. All "
},
{
"path": "src/differential.h",
"chars": 39908,
"preview": "#ifndef DIFFERENTIAL_H\n#define DIFFERENTIAL_H\n/*\n * differential.h\n * cufflinks\n *\n * Created by Cole Trapnell on 3/1"
},
{
"path": "src/filters.cpp",
"chars": 36728,
"preview": "/*\n * filters.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 10/27/09.\n * Copyright 2009 Cole Trapnell. All righ"
},
{
"path": "src/filters.h",
"chars": 1035,
"preview": "#ifndef FILTERS_H\n#define FILTERS_H\n\n/*\n * filters.h\n * cufflinks\n *\n * Created by Cole Trapnell on 10/27/09.\n * Cop"
},
{
"path": "src/gdna.cpp",
"chars": 2081,
"preview": "#include \"gdna.h\"\n#include <string.h>\n\nconst char* IUPAC_2BIT =\"AACCTTGGTTAAAAAACCCCGGAAAAAACCAAAAAA\";\nconst char* IUPA"
},
{
"path": "src/gdna.h",
"chars": 372,
"preview": "#ifndef GDNA_H\n#define GDNA_H\n#include \"GBase.h\"\n\nchar ntComplement(char c);\n\n//in-place reverse complement of a nucleot"
},
{
"path": "src/genes.cpp",
"chars": 3643,
"preview": "/*\n * genes.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 8/23/09.\n * Copyright 2009 Cole Trapnell. All rights "
},
{
"path": "src/genes.h",
"chars": 5148,
"preview": "#ifndef ISOFORM_H\n#define ISOFORM_H\n\n/*\n * genes.h\n * cufflinks\n *\n * Created by Cole Trapnell on 8/23/09.\n * Copyri"
},
{
"path": "src/gff.cpp",
"chars": 73566,
"preview": "#include \"gff.h\"\n\nGffNames* GffObj::names=NULL;\n//global set of feature names, attribute names etc.\n// -- common for all"
},
{
"path": "src/gff.h",
"chars": 35902,
"preview": "#ifndef GFF_H\n#define GFF_H\n\n#define CUFFLINKS 1\n\n#include \"GBase.h\"\n#include \"gdna.h\"\n#include \"codons.h\"\n#include \"GFa"
},
{
"path": "src/gff_utils.cpp",
"chars": 23657,
"preview": "#include \"gff_utils.h\"\n\nextern bool verbose;\nextern bool debugMode;\n\n//bool debugState=false;\n\nvoid printFasta(FILE* f, "
},
{
"path": "src/gff_utils.h",
"chars": 20688,
"preview": "#ifndef GFF_UTILS_H\n#define GFF_UTILS_H\n#include \"gff.h\"\n#include \"GStr.h\"\n#include \"GFastaIndex.h\"\n#include \"GFaSeqGet."
},
{
"path": "src/gffread.cpp",
"chars": 37458,
"preview": "#include \"GArgs.h\"\n#include \"gff_utils.h\"\n#include <ctype.h>\n// don't care about cdb compression\n//#ifdef ENABLE_COMPRES"
},
{
"path": "src/graph_optimize.cpp",
"chars": 21728,
"preview": "/*\n * graph_optimize.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 6/1/10.\n * Copyright 2010 Cole Trapnell. All"
},
{
"path": "src/graph_optimize.h",
"chars": 2557,
"preview": "#ifndef GRAPH_OPTIMIZE_H\n#define GRAPH_OPTIMIZE_H\n/*\n * graph_optimize.h\n * cufflinks\n *\n * Created by Cole Trapnell "
},
{
"path": "src/gtf_reads.cpp",
"chars": 3943,
"preview": "/*\n * reads_of_interest.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 11/29/09.\n * Copyright 2009 Cole Trapnell"
},
{
"path": "src/gtf_to_sam.cpp",
"chars": 8404,
"preview": "/*\n * gtf_to_sam.cpp\n * Cufflinks\n *\n * Created by Cole Trapnell on 8/1/10.\n * Copyright 2009 Cole Trapnell. All rig"
},
{
"path": "src/gtf_tracking.cpp",
"chars": 26889,
"preview": "/*\n * gtf_tracking.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 9/5/09.\n * Copyright 2009 Geo Pertea. All righ"
},
{
"path": "src/gtf_tracking.h",
"chars": 46360,
"preview": "#ifndef GTF_TRACKING_H\n#define GTF_TRACKING_H\n/*\n * gtf_tracking.h\n *\n */\n\n#ifdef HEAPROFILE\n#include \"gperftools/heap-"
},
{
"path": "src/hits.cpp",
"chars": 35272,
"preview": "/*\n * hits.cpp\n * Cufflinks\n *\n * Created by Cole Trapnell on 3/23/09.\n * Copyright 2009 Cole Trapnell. All rights r"
},
{
"path": "src/hits.h",
"chars": 30159,
"preview": "#ifndef BWT_MAP_H\n#define BWT_MAP_H\n\n#ifdef HAVE_CONFIG_H\n#include <config.h>\n#endif\n\n#include <iostream>\n#include <fstr"
},
{
"path": "src/jensen_shannon.cpp",
"chars": 4786,
"preview": "/*\n * jensen_shannon.cpp\n * cufflinks\n *\n * Created by Cole Trapnell on 8/30/10.\n * Copyright 2010 Cole Trapnell. Al"
},
{
"path": "src/jensen_shannon.h",
"chars": 847,
"preview": "/*\n * jensen_shannon.h\n * cufflinks\n *\n * Created by Cole Trapnell on 8/30/10.\n * Copyright 2010 Cole Trapnell. All "
},
{
"path": "src/lemon/bfs.h",
"chars": 48902,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bin_heap.h",
"chars": 10171,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bipartite_matching.h",
"chars": 50185,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/alteration_notifier.h",
"chars": 16097,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/array_map.h",
"chars": 9872,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/base_extender.h",
"chars": 11703,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/debug_map.h",
"chars": 12621,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/default_map.h",
"chars": 4721,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/graph_adaptor_extender.h",
"chars": 16968,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/graph_extender.h",
"chars": 31643,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/invalid.h",
"chars": 1399,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/map_extender.h",
"chars": 6468,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/path_dump.h",
"chars": 4544,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/traits.h",
"chars": 9264,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/utility.h",
"chars": 3437,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/variant.h",
"chars": 14685,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bits/vector_map.h",
"chars": 7427,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/bucket_heap.h",
"chars": 21563,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/concept_check.h",
"chars": 3779,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/concepts/bpugraph.h",
"chars": 32837,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/concepts/graph.h",
"chars": 14284,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/concepts/graph_components.h",
"chars": 65066,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/concepts/heap.h",
"chars": 6644,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/concepts/maps.h",
"chars": 5262,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/concepts/matrix_maps.h",
"chars": 6138,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/concepts/path.h",
"chars": 8427,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/concepts/ugraph.h",
"chars": 23177,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/dfs.h",
"chars": 46652,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/error.h",
"chars": 18243,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/fib_heap.h",
"chars": 13336,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/graph_adaptor.h",
"chars": 82757,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/graph_utils.h",
"chars": 95390,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/list_graph.h",
"chars": 62815,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/maps.h",
"chars": 47515,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/math.h",
"chars": 1808,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/smart_graph.h",
"chars": 28821,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/tolerance.h",
"chars": 13460,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/lemon/topology.h",
"chars": 46347,
"preview": "/* -*- C++ -*-\n *\n * This file is a part of LEMON, a generic C++ optimization library\n *\n * Copyright (C) 2003-2008\n * E"
},
{
"path": "src/locfit/adap.c",
"chars": 4870,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n/*\n Functions implementing "
},
{
"path": "src/locfit/ar_funs.c",
"chars": 2761,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n * \n *\n * ar_setfunction sets a "
},
{
"path": "src/locfit/arith.c",
"chars": 15069,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n */\n\n#include <ctype.h>\n#include "
},
{
"path": "src/locfit/band.c",
"chars": 10033,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\nextern l"
},
{
"path": "src/locfit/c_args.c",
"chars": 1798,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n *\n * Functions for interpretin"
},
{
"path": "src/locfit/c_plot.c",
"chars": 11090,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\nvari *gr"
},
{
"path": "src/locfit/cmd.c",
"chars": 23518,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n */\n\n#include <unistd.h>\n#ifdef D"
},
{
"path": "src/locfit/dens_haz.c",
"chars": 4976,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n *\n * Integration for haz"
},
{
"path": "src/locfit/dens_int.c",
"chars": 5438,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n * The function dens_inte"
},
{
"path": "src/locfit/dens_odi.c",
"chars": 12762,
"preview": "/*\n * Copyright (c) 1996-200 Lucent Technologies.\n * See README file for details.\n *\n *\n *\n * Routines for one-dime"
},
{
"path": "src/locfit/density.c",
"chars": 12952,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\nextern i"
},
{
"path": "src/locfit/design.h",
"chars": 931,
"preview": "/*\n * Copyright (c) 1998-2000 Lucent Technologies.\n * See README file for details.\n *\n *\n * The design structure u"
},
{
"path": "src/locfit/dist.c",
"chars": 3664,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\n#define "
},
{
"path": "src/locfit/ev_atree.c",
"chars": 4865,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n * This file contains functi"
},
{
"path": "src/locfit/ev_interp.c",
"chars": 6159,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\ndouble l"
},
{
"path": "src/locfit/ev_kdtre.c",
"chars": 8108,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n * Routines for building and"
},
{
"path": "src/locfit/ev_main.c",
"chars": 6521,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\nvoid kdt"
},
{
"path": "src/locfit/ev_trian.c",
"chars": 13069,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\nINT tria"
},
{
"path": "src/locfit/family.c",
"chars": 14255,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\n#define "
},
{
"path": "src/locfit/fitted.c",
"chars": 3521,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n/*\n Functions for computing"
},
{
"path": "src/locfit/frend.c",
"chars": 10720,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\nextern I"
},
{
"path": "src/locfit/help.c",
"chars": 1892,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n *\n *\n *\n * The example() funct"
},
{
"path": "src/locfit/imatlb.h",
"chars": 886,
"preview": "typedef struct {\n int n;\n double *dpr;\n} vari; \n\ntypedef struct {\n double *Z, *Q, *dg, *f2;\n int p, sm; } xtwxstr"
},
{
"path": "src/locfit/lf_dercor.c",
"chars": 1431,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n * Derivative corrections"
},
{
"path": "src/locfit/lf_fitfun.c",
"chars": 6347,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n * Evaluate the locfit fi"
},
{
"path": "src/locfit/lf_robust.c",
"chars": 3097,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n * This file includes fun"
},
{
"path": "src/locfit/lf_vari.c",
"chars": 4154,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n * Post-fitting functions"
},
{
"path": "src/locfit/lfcons.h",
"chars": 5748,
"preview": "/*\n * Copyright (c) 1998 Lucent Technologies.\n * See README file for details.\n */\n\n/*\n Numeric values for constants"
},
{
"path": "src/locfit/lfd.c",
"chars": 7105,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n */\n\n\n/* Functions for reading/wr"
},
{
"path": "src/locfit/lffuns.h",
"chars": 5042,
"preview": "\n\n\n/* FILES IN THE src DIRECTORY */\n\n/* adap.c */\nextern double afit(), aband2(), aband3();\nextern INT ainitband();\n\n/* "
},
{
"path": "src/locfit/lfstr.c",
"chars": 4169,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n *\n * setstrval() is a fu"
},
{
"path": "src/locfit/lfstruc.h",
"chars": 2337,
"preview": "/*\n * Copyright (c) 1998-2000 Lucent Technologies.\n * See README file for details.\n *\n *\n *\n * Structures, typedef"
},
{
"path": "src/locfit/lfwin.h",
"chars": 2097,
"preview": "#define LFM_EXIT 0\r\n#define LFM_COPY 1\r\n#define LFM_PASTE 2\r\n#define LFM_RUN 3\r\n\r\n#define LFM_READA 10\r\n#define "
},
{
"path": "src/locfit/linalg.c",
"chars": 7583,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\nvoid svd"
},
{
"path": "src/locfit/local.h",
"chars": 2955,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n * \n *\n * Most of the changes fo"
},
{
"path": "src/locfit/locfit.c",
"chars": 6647,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\nstatic d"
},
{
"path": "src/locfit/m_chol.c",
"chars": 1233,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include <math.h>\n#include \""
},
{
"path": "src/locfit/m_eigen.c",
"chars": 2639,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include <math.h>\n#include \""
},
{
"path": "src/locfit/m_jacob.c",
"chars": 2443,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include <stdlib.h>\n#include"
},
{
"path": "src/locfit/m_max.c",
"chars": 6054,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n * Routines for maximizati"
},
{
"path": "src/locfit/makecmd.c",
"chars": 5397,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n *\n *\n * The makecmd() function"
},
{
"path": "src/locfit/math.c",
"chars": 3632,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n miscellaneous functions t"
},
{
"path": "src/locfit/minmax.c",
"chars": 7818,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n * Compute minimax weight"
},
{
"path": "src/locfit/mutil.h",
"chars": 1348,
"preview": "/*\n * Copyright (c) 1998-2000 Lucent Technologies.\n * See README file for details.\n *\n *\n * Headers for math utili"
},
{
"path": "src/locfit/nbhd.c",
"chars": 4578,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n *\n * Functions for determ"
},
{
"path": "src/locfit/pcomp.c",
"chars": 4474,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n * \n *\n * functions for computing"
},
{
"path": "src/locfit/pout.c",
"chars": 20828,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n *\n *\n * print a plot structure i"
},
{
"path": "src/locfit/preplot.c",
"chars": 5394,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\n/*\n prep"
},
{
"path": "src/locfit/random.c",
"chars": 3267,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\n#define "
},
{
"path": "src/locfit/readfile.c",
"chars": 1837,
"preview": "/*\n * Copyright (c) 1996-2000 Lucent Technologies.\n * See README file for details.\n *\n *\n *\n * Function to read an"
},
{
"path": "src/locfit/scb.c",
"chars": 7662,
"preview": "/*\n * Copyright (c) 1996-2001 Jiayang Sun, Catherine Loader.\n * This file is used by the simultaneous confidence ban"
},
{
"path": "src/locfit/scb_cons.c",
"chars": 8464,
"preview": "/*\n * Copyright (c) 1996-2001 Jiayang Sun, Catherine Loader.\n * This file is used by the simultaneous confidence ban"
},
{
"path": "src/locfit/simul.c",
"chars": 5400,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n */\n\n#include \"local.h\"\n\nstatic d"
},
{
"path": "src/locfit/solve.c",
"chars": 2973,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n * solve f(x)=c by various"
},
{
"path": "src/locfit/startlf.c",
"chars": 11704,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n *\n startlf(des,lf,vfun,nop"
},
{
"path": "src/locfit/strings.c",
"chars": 3295,
"preview": "/*\n * Copyright (c) 1996-2001 Lucent Technologies.\n * See README file for details.\n *\n *\n *\n * miscellaneous string"
}
]
// ... and 35 more files (download for full content)
About this extraction
This page contains the full source code of the cole-trapnell-lab/cufflinks GitHub repository, extracted and formatted as plain text for AI agents and large language models (LLMs). The extraction includes 235 files (4.7 MB), approximately 1.2M tokens, and a symbol index with 2758 extracted functions, classes, methods, constants, and types. Use this with OpenClaw, Claude, ChatGPT, Cursor, Windsurf, or any other AI tool that accepts text input. You can copy the full output to your clipboard or download it as a .txt file.
Extracted by GitExtract — free GitHub repo to text converter for AI. Built by Nikandr Surkov.