Full Code of dguo/strsim-rs for AI

main dacc84c0dc61 cached
14 files
54.4 KB
16.8k tokens
145 symbols
1 requests
Download .txt
Repository: dguo/strsim-rs
Branch: main
Commit: dacc84c0dc61
Files: 14
Total size: 54.4 KB

Directory structure:
gitextract_h7ck84ay/

├── .editorconfig
├── .gitattributes
├── .github/
│   ├── FUNDING.yml
│   └── workflows/
│       └── ci.yml
├── .gitignore
├── CHANGELOG.md
├── Cargo.toml
├── LICENSE
├── README.md
├── SECURITY.md
├── benches/
│   └── benches.rs
├── dev
├── src/
│   └── lib.rs
└── tests/
    └── lib.rs

================================================
FILE CONTENTS
================================================

================================================
FILE: .editorconfig
================================================
# editorconfig.org
root = true

[*]
charset = utf-8
end_of_line = lf
indent_brace_style = K&R
indent_size = 4
indent_style = space
insert_final_newline = true
max_line_length = 80
trim_trailing_whitespace = true



================================================
FILE: .gitattributes
================================================
# Override core.autocrlf settings to keep line endings consistent (LF)
* text=auto



================================================
FILE: .github/FUNDING.yml
================================================
github: [dguo, maxbachmann]
ko_fi: dannyguo
liberapay: dannyguo
custom: ["https://www.paypal.com/donate/?hosted_button_id=VGWQBBD5CTWJU", "https://www.paypal.com/paypalme/DannyGuo", "https://www.buymeacoffee.com/dannyguo"]


================================================
FILE: .github/workflows/ci.yml
================================================
name: CI

on:
  push:
    branches:
      - main
  pull_request:

jobs:
  build:
    strategy:
      matrix:
        os: ["macos-latest", "ubuntu-latest", "windows-latest"]
        rust: ["1.56", "beta", "stable"]

    runs-on: ${{ matrix.os }}

    steps:
      - uses: actions/checkout@v4
      - name: Install Rust
        uses: dtolnay/rust-toolchain@master
        with:
          toolchain: ${{ matrix.rust }}
      - name: Build the code
        run: cargo build --verbose
      - name: Test the code
        run: cargo test --verbose
  check-formatting:
    runs-on: ubuntu-latest
    steps:
      - uses: actions/checkout@v4
      - name: Install Rust
        uses: dtolnay/rust-toolchain@stable
      - name: Check formatting
        run: cargo fmt --check


================================================
FILE: .gitignore
================================================
/target
/Cargo.lock
*.swp
*.swo
.DS_Store


================================================
FILE: CHANGELOG.md
================================================
# Change Log

This project attempts to adhere to [Semantic Versioning](http://semver.org).

## [Unreleased]

## [0.11.1] - (2024-04-03)

### Fixed

- Drop MSRV down to 1.56 which was mistakenly changed in 0.11.0

## [0.11.0] - (2024-01-07)

### Changed

- improve OSA implementation
  - reduce runtime
  - reduce binary size by more than `25%`

- reduce binary size of Levenshtein distance

- improve Damerau-Levenshtein implementation
  - reduce memory usage from `O(N*M)` to `O(N+M)`
  - reduce runtime in our own benchmark by more than `70%`
  - reduce binary size by more than `25%`

- only boost similarity in Jaro-Winkler once the Jaro similarity exceeds 0.7

### Fixed

- Fix transposition counting in Jaro and Jaro-Winkler.
- Limit common prefix in Jaro-Winkler to 4 characters

## [0.10.0] - (2020-01-31)

### Added

- Sørensen-Dice implementation (thanks [@robjtede](https://github.com/robjtede))

## [0.9.3] - (2019-12-12)

### Fixed

- Fix Jaro and Jaro-Winkler when the arguments have lengths of 1 and are equal.
  Previously, the functions would erroneously return 0 instead of 1. Thanks to
  [@vvrably](https://github.com/vvrably) for pointing out the issue.

## [0.9.2] - (2019-05-09)

### Changed

- Revert back to the standard library hashmap because it will use hashbrown very
  soon
- Remove ndarray in favor of using a single vector to represent the 2d grid in
  Damerau-Levenshtein

## [0.9.1] - (2019-04-08)

### Changed

- Faster Damerau-Levenshtein implementation (thanks [@lovasoa](https://github.com/lovasoa))

## [0.9.0] - (2019-04-06)

### Added

- Generic distance functions (thanks [@lovasoa](https://github.com/lovasoa))

## [0.8.0] - (2018-08-19)

### Added

- Normalized versions of Levenshtein and Damerau-Levenshtein (thanks [@gentoid](https://github.com/gentoid))

## [0.7.0] - (2018-01-17)

### Changed

- Faster Levenshtein implementation (thanks [@wdv4758h](https://github.com/wdv4758h))

### Removed

- Remove the "against_vec" functions. They are one-liners now, so they don't
  seem to add enough value to justify making the API larger. I didn't find
  anybody using them when I skimmed through a GitHub search. If you do use them,
  you can change the calls to something like:
```rust
let distances = strings.iter().map(|a| jaro(target, a)).collect();
```

## [0.6.0] - (2016-12-26)

### Added

- Add optimal string alignment distance

### Fixed

- Fix Damerau-Levenshtein implementation (previous implementation was actually
  optimal string alignment; see this [Damerau-Levenshtein explanation])

## [0.5.2] - (2016-11-21)

### Changed

- Remove Cargo generated documentation in favor of a [docs.rs] link

## [0.5.1] - (2016-08-23)

### Added

- Add Cargo generated documentation

### Fixed

- Fix panic when Jaro or Jaro-Winkler are given strings both with a length of
  one

## [0.5.0] - (2016-08-11)

### Changed

- Make Hamming faster (thanks @IBUzPE9) when the two strings have the same
  length but slower when they have different lengths

## [0.4.1] - (2016-04-18)

### Added

- Add Vagrant setup for development
- Add AppVeyor configuration for Windows CI

### Fixed

- Fix metrics when given strings with multibyte characters (thanks @WanzenBug)

## [0.4.0] - (2015-06-10)

### Added

- For each metric, add a function that takes a vector of strings and returns a
vector of results (thanks @ovarene)

## [0.3.0] - (2015-04-30)

### Changed

- Remove usage of unstable Rust features

## [0.2.5] - (2015-04-24)

### Fixed

- Remove unnecessary `Float` import from doc tests

## [0.2.4] - (2015-04-15)

### Fixed

- Remove unused `core` feature flag

## [0.2.3] - (2015-04-01)

### Fixed

- Remove now unnecessary `Float` import

## [0.2.2] - (2015-03-29)

### Fixed

- Remove usage of `char_at` (marked as unstable)

## [0.2.1] - (2015-02-20)

### Fixed

- Update bit vector import to match Rust update

## [0.2.0] - (2015-02-19)

### Added

- Implement Damerau-Levenshtein
- Add tests in docs

## [0.1.1] - (2015-02-10)

### Added

- Configure Travis for CI
- Add rustdoc comments

### Fixed

- Limit Jaro-Winkler return value to a maximum of 1.0
- Fix float comparisons in tests

## [0.1.0] - (2015-02-09)

### Added

- Implement Hamming, Jaro, Jaro-Winkler, and Levenshtein

[Unreleased]: https://github.com/rapidfuzz/strsim-rs/compare/0.11.1...HEAD
[0.11.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.11.0...0.11.1
[0.11.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.10.0...0.11.0
[0.10.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.9.3...0.10.0
[0.9.3]: https://github.com/rapidfuzz/strsim-rs/compare/0.9.2...0.9.3
[0.9.2]: https://github.com/rapidfuzz/strsim-rs/compare/0.9.1...0.9.2
[0.9.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.9.0...0.9.1
[0.9.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.8.0...0.9.0
[0.8.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.7.0...0.8.0
[0.7.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.6.0...0.7.0
[0.6.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.5.2...0.6.0
[0.5.2]: https://github.com/rapidfuzz/strsim-rs/compare/0.5.1...0.5.2
[0.5.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.5.0...0.5.1
[0.5.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.4.1...0.5.0
[0.4.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.4.0...0.4.1
[0.4.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.3.0...0.4.0
[0.3.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.5...0.3.0
[0.2.5]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.4...0.2.5
[0.2.4]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.3...0.2.4
[0.2.3]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.2...0.2.3
[0.2.2]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.1...0.2.2
[0.2.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.2.0...0.2.1
[0.2.0]: https://github.com/rapidfuzz/strsim-rs/compare/0.1.1...0.2.0
[0.1.1]: https://github.com/rapidfuzz/strsim-rs/compare/0.1.0...0.1.1
[0.1.0]: https://github.com/rapidfuzz/strsim-rs/compare/fabad4...0.1.0
[docs.rs]: https://docs.rs/strsim/
[Damerau-Levenshtein explanation]:
http://scarcitycomputing.blogspot.com/2013/04/damerau-levenshtein-edit-distance.html


================================================
FILE: Cargo.toml
================================================
[package]
name = "strsim"
version = "0.11.1"
authors = ["Danny Guo <danny@dannyguo.com>", "maxbachmann <oss@maxbachmann.de>"]
description = """
Implementations of string similarity metrics. Includes Hamming, Levenshtein,
OSA, Damerau-Levenshtein, Jaro, Jaro-Winkler, and Sørensen-Dice.
"""
edition = "2021"
license = "MIT"
rust-version = "1.56"
readme = "README.md"
keywords = ["string", "similarity", "Hamming", "Levenshtein", "Jaro"]
homepage = "https://github.com/rapidfuzz/strsim-rs"
repository = "https://github.com/rapidfuzz/strsim-rs"
documentation = "https://docs.rs/strsim/"
exclude = ["/.github", "/dev"]
categories = ["text-processing"]


================================================
FILE: LICENSE
================================================
The MIT License (MIT)

Copyright (c) 2015 Danny Guo
Copyright (c) 2016 Titus Wormer <tituswormer@gmail.com>
Copyright (c) 2018 Akash Kurdekar

Permission is hereby granted, free of charge, to any person obtaining a copy
of this software and associated documentation files (the "Software"), to deal
in the Software without restriction, including without limitation the rights
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
copies of the Software, and to permit persons to whom the Software is
furnished to do so, subject to the following conditions:

The above copyright notice and this permission notice shall be included in all
copies or substantial portions of the Software.

THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.


================================================
FILE: README.md
================================================
# strsim-rs

[![Crates.io](https://img.shields.io/crates/v/strsim.svg)](https://crates.io/crates/strsim)
[![Crates.io](https://img.shields.io/crates/l/strsim.svg?maxAge=2592000)](https://github.com/rapidfuzz/strsim-rs/blob/main/LICENSE)
[![CI status](https://github.com/rapidfuzz/strsim-rs/workflows/CI/badge.svg)](https://github.com/rapidfuzz/strsim-rs/actions?query=branch%3Amain)
[![unsafe forbidden](https://img.shields.io/badge/unsafe-forbidden-success.svg)](https://github.com/rust-secure-code/safety-dance/)

[Rust](https://www.rust-lang.org) implementations of [string similarity metrics]:
  - [Hamming]
  - [Levenshtein] - distance & normalized
  - [Optimal string alignment]
  - [Damerau-Levenshtein] - distance & normalized
  - [Jaro and Jaro-Winkler]
  - [Sørensen-Dice]

The normalized versions return values between `0.0` and `1.0`, where `1.0` means
an exact match.

There are also generic versions of the functions for non-string inputs.

## Installation

`strsim` is available on [crates.io](https://crates.io/crates/strsim). Add it to
your project:

```sh
cargo add strsim
```

## Usage

Go to [Docs.rs](https://docs.rs/strsim/) for the full documentation. You can
also clone the repo, and run `$ cargo doc --open`.

### Examples

```rust
extern crate strsim;

use strsim::{hamming, levenshtein, normalized_levenshtein, osa_distance,
             damerau_levenshtein, normalized_damerau_levenshtein, jaro,
             jaro_winkler, sorensen_dice};

fn main() {
    match hamming("hamming", "hammers") {
        Ok(distance) => assert_eq!(3, distance),
        Err(why) => panic!("{:?}", why)
    }

    assert_eq!(levenshtein("kitten", "sitting"), 3);

    assert!((normalized_levenshtein("kitten", "sitting") - 0.571).abs() < 0.001);

    assert_eq!(osa_distance("ac", "cba"), 3);

    assert_eq!(damerau_levenshtein("ac", "cba"), 2);

    assert!((normalized_damerau_levenshtein("levenshtein", "löwenbräu") - 0.272).abs() <
            0.001);

    assert!((jaro("Friedrich Nietzsche", "Jean-Paul Sartre") - 0.392).abs() <
            0.001);

    assert!((jaro_winkler("cheeseburger", "cheese fries") - 0.911).abs() <
            0.001);

    assert_eq!(sorensen_dice("web applications", "applications of the web"),
        0.7878787878787878);
}
```

Using the generic versions of the functions:

```rust
extern crate strsim;

use strsim::generic_levenshtein;

fn main() {
    assert_eq!(2, generic_levenshtein(&[1, 2, 3], &[0, 2, 5]));
}
```

## Contributing

If you don't want to install Rust itself, you can run `$ ./dev` for a
development CLI if you have [Docker] installed.

Benchmarks require a Nightly toolchain. Run `$ cargo +nightly bench`.

## License

[MIT](https://github.com/rapidfuzz/strsim-rs/blob/main/LICENSE)

[string similarity metrics]:http://en.wikipedia.org/wiki/String_metric
[Damerau-Levenshtein]:http://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance
[Jaro and Jaro-Winkler]:http://en.wikipedia.org/wiki/Jaro%E2%80%93Winkler_distance
[Levenshtein]:http://en.wikipedia.org/wiki/Levenshtein_distance
[Hamming]:http://en.wikipedia.org/wiki/Hamming_distance
[Optimal string alignment]:https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance#Optimal_string_alignment_distance
[Sørensen-Dice]:http://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient
[Docker]:https://docs.docker.com/engine/installation/


================================================
FILE: SECURITY.md
================================================
## Reporting Security Issues

If you believe you have found a security vulnerability in the project, please report it to us through coordinated disclosure.

**Please do not report security vulnerabilities through public GitHub issues, discussions, or pull requests.**

Instead, please send an email to oss@maxbachmann.de.

Please include as much of the information listed below as you can to help us better understand and resolve the issue:

  * The type of issue (e.g., buffer overflow, SQL injection, or cross-site scripting)
  * Full paths of source file(s) related to the manifestation of the issue
  * The location of the affected source code (tag/branch/commit or direct URL)
  * Any special configuration required to reproduce the issue
  * Step-by-step instructions to reproduce the issue
  * Proof-of-concept or exploit code (if possible)
  * Impact of the issue, including how an attacker might exploit the issue

This information will help us triage your report more quickly.


================================================
FILE: benches/benches.rs
================================================
//! Benchmarks for strsim.

#![feature(test)]

extern crate strsim;
extern crate test;
use self::test::Bencher;

#[bench]
fn bench_hamming(bencher: &mut Bencher) {
    let a = "ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGG";
    let b = "CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGC";
    bencher.iter(|| {
        strsim::hamming(a, b).unwrap();
    })
}

#[bench]
fn bench_jaro(bencher: &mut Bencher) {
    let a = "Philosopher Friedrich Nietzsche";
    let b = "Philosopher Jean-Paul Sartre";
    bencher.iter(|| {
        strsim::jaro(a, b);
    })
}

#[bench]
fn bench_jaro_winkler(bencher: &mut Bencher) {
    let a = "Philosopher Friedrich Nietzsche";
    let b = "Philosopher Jean-Paul Sartre";
    bencher.iter(|| {
        strsim::jaro_winkler(a, b);
    })
}

#[bench]
fn bench_levenshtein(bencher: &mut Bencher) {
    let a = "Philosopher Friedrich Nietzsche";
    let b = "Philosopher Jean-Paul Sartre";
    bencher.iter(|| {
        strsim::levenshtein(a, b);
    })
}

#[bench]
fn bench_levenshtein_on_u8(bencher: &mut Bencher) {
    bencher.iter(|| {
        strsim::generic_levenshtein(&vec![0u8; 30], &vec![7u8; 31]);
    })
}

#[bench]
fn bench_normalized_levenshtein(bencher: &mut Bencher) {
    let a = "Philosopher Friedrich Nietzsche";
    let b = "Philosopher Jean-Paul Sartre";
    bencher.iter(|| {
        strsim::normalized_levenshtein(a, b);
    })
}

#[bench]
fn bench_osa_distance(bencher: &mut Bencher) {
    let a = "Philosopher Friedrich Nietzsche";
    let b = "Philosopher Jean-Paul Sartre";
    bencher.iter(|| {
        strsim::osa_distance(a, b);
    })
}

#[bench]
fn bench_damerau_levenshtein(bencher: &mut Bencher) {
    let a = "Philosopher Friedrich Nietzsche";
    let b = "Philosopher Jean-Paul Sartre";
    bencher.iter(|| {
        strsim::damerau_levenshtein(a, b);
    })
}

#[bench]
fn bench_normalized_damerau_levenshtein(bencher: &mut Bencher) {
    let a = "Philosopher Friedrich Nietzsche";
    let b = "Philosopher Jean-Paul Sartre";
    bencher.iter(|| {
        strsim::normalized_damerau_levenshtein(a, b);
    })
}

#[bench]
fn bench_sorensen_dice(bencher: &mut Bencher) {
    let a = "Philosopher Friedrich Nietzsche";
    let b = "Philosopher Jean-Paul Sartre";
    bencher.iter(|| {
        strsim::sorensen_dice(a, b);
    })
}


================================================
FILE: dev
================================================
#!/usr/bin/env python3
# ./dev --help

import argparse
import os
from subprocess import run
import sys

parser = argparse.ArgumentParser(prog='./dev')
subparsers = parser.add_subparsers(metavar='<command>', title='commands')
command = [
    'docker', 'run', '-it', '--rm', '-v', os.getcwd() + ':/src:cached',
    '-w=/src', 'rust:1.31.0'
]

def cargo(args, remaining):
    sys.exit(run(command + ['cargo'] + remaining or []).returncode)

parser_cargo = subparsers.add_parser('cargo', help='run a cargo command')
parser_cargo.set_defaults(func=cargo)

def sh(args, remaining):
    sys.exit(run(command + ['bash']).returncode)

parser_sh = subparsers.add_parser('sh', help='bring up a shell')
parser_sh.set_defaults(func=sh)

def test(args, remaining):
    sys.exit(run(command + ['cargo', 'test']).returncode)

parser_test = subparsers.add_parser('test', help='run tests')
parser_test.set_defaults(func=test)

if len(sys.argv) > 1:
    args, remaining = parser.parse_known_args()
    try:
        args.func(args, remaining)
    except FileNotFoundError:
        sys.exit('Please install Docker.')
else:
    parser.print_help()


================================================
FILE: src/lib.rs
================================================
//! This library implements string similarity metrics.

#![forbid(unsafe_code)]
#![warn(rust_2018_idioms)]
#![allow(
    // these casts are sometimes needed. They restrict the length of input iterators
    // but there isn't really any way around this except for always working with
    // 128 bit types
    clippy::cast_possible_wrap,
    clippy::cast_sign_loss,
    clippy::cast_precision_loss,
    // not practical
    clippy::similar_names,
    // noisy
    clippy::missing_errors_doc,
    clippy::missing_panics_doc,
    clippy::must_use_candidate,
    // todo https://github.com/rapidfuzz/strsim-rs/issues/59
    clippy::range_plus_one
)]

use std::char;
use std::cmp::{max, min};
use std::collections::HashMap;
use std::convert::TryFrom;
use std::error::Error;
use std::fmt::{self, Display, Formatter};
use std::hash::Hash;
use std::mem;
use std::str::Chars;

#[derive(Debug, PartialEq)]
pub enum StrSimError {
    DifferentLengthArgs,
}

impl Display for StrSimError {
    fn fmt(&self, fmt: &mut Formatter<'_>) -> Result<(), fmt::Error> {
        let text = match self {
            StrSimError::DifferentLengthArgs => "Differing length arguments provided",
        };

        write!(fmt, "{}", text)
    }
}

impl Error for StrSimError {}

pub type HammingResult = Result<usize, StrSimError>;

/// Calculates the number of positions in the two sequences where the elements
/// differ. Returns an error if the sequences have different lengths.
pub fn generic_hamming<Iter1, Iter2, Elem1, Elem2>(a: Iter1, b: Iter2) -> HammingResult
where
    Iter1: IntoIterator<Item = Elem1>,
    Iter2: IntoIterator<Item = Elem2>,
    Elem1: PartialEq<Elem2>,
{
    let (mut ita, mut itb) = (a.into_iter(), b.into_iter());
    let mut count = 0;
    loop {
        match (ita.next(), itb.next()) {
            (Some(x), Some(y)) => {
                if x != y {
                    count += 1;
                }
            }
            (None, None) => return Ok(count),
            _ => return Err(StrSimError::DifferentLengthArgs),
        }
    }
}

/// Calculates the number of positions in the two strings where the characters
/// differ. Returns an error if the strings have different lengths.
///
/// ```
/// use strsim::{hamming, StrSimError::DifferentLengthArgs};
///
/// assert_eq!(Ok(3), hamming("hamming", "hammers"));
///
/// assert_eq!(Err(DifferentLengthArgs), hamming("hamming", "ham"));
/// ```
pub fn hamming(a: &str, b: &str) -> HammingResult {
    generic_hamming(a.chars(), b.chars())
}

/// Calculates the Jaro similarity between two sequences. The returned value
/// is between 0.0 and 1.0 (higher value means more similar).
pub fn generic_jaro<'a, 'b, Iter1, Iter2, Elem1, Elem2>(a: &'a Iter1, b: &'b Iter2) -> f64
where
    &'a Iter1: IntoIterator<Item = Elem1>,
    &'b Iter2: IntoIterator<Item = Elem2>,
    Elem1: PartialEq<Elem2>,
{
    let a_len = a.into_iter().count();
    let b_len = b.into_iter().count();

    if a_len == 0 && b_len == 0 {
        return 1.0;
    } else if a_len == 0 || b_len == 0 {
        return 0.0;
    }

    let mut search_range = max(a_len, b_len) / 2;
    search_range = search_range.saturating_sub(1);

    // combine memory allocations to reduce runtime
    let mut flags_memory = vec![false; a_len + b_len];
    let (a_flags, b_flags) = flags_memory.split_at_mut(a_len);

    let mut matches = 0_usize;

    for (i, a_elem) in a.into_iter().enumerate() {
        // prevent integer wrapping
        let min_bound = i.saturating_sub(search_range);

        let max_bound = min(b_len, i + search_range + 1);

        for (j, b_elem) in b.into_iter().enumerate().take(max_bound) {
            if min_bound <= j && a_elem == b_elem && !b_flags[j] {
                a_flags[i] = true;
                b_flags[j] = true;
                matches += 1;
                break;
            }
        }
    }

    let mut transpositions = 0_usize;
    if matches != 0 {
        let mut b_iter = b_flags.iter().zip(b);
        for (a_flag, ch1) in a_flags.iter().zip(a) {
            if *a_flag {
                loop {
                    if let Some((b_flag, ch2)) = b_iter.next() {
                        if !*b_flag {
                            continue;
                        }

                        if ch1 != ch2 {
                            transpositions += 1;
                        }
                        break;
                    }
                }
            }
        }
    }
    transpositions /= 2;

    if matches == 0 {
        0.0
    } else {
        ((matches as f64 / a_len as f64)
            + (matches as f64 / b_len as f64)
            + ((matches - transpositions) as f64 / matches as f64))
            / 3.0
    }
}

struct StringWrapper<'a>(&'a str);

impl<'b> IntoIterator for &StringWrapper<'b> {
    type Item = char;
    type IntoIter = Chars<'b>;

    fn into_iter(self) -> Self::IntoIter {
        self.0.chars()
    }
}

/// Calculates the Jaro similarity between two strings. The returned value
/// is between 0.0 and 1.0 (higher value means more similar).
///
/// ```
/// use strsim::jaro;
///
/// assert!((0.392 - jaro("Friedrich Nietzsche", "Jean-Paul Sartre")).abs() <
///         0.001);
/// ```
pub fn jaro(a: &str, b: &str) -> f64 {
    generic_jaro(&StringWrapper(a), &StringWrapper(b))
}

/// Like Jaro but gives a boost to sequences that have a common prefix.
pub fn generic_jaro_winkler<'a, 'b, Iter1, Iter2, Elem1, Elem2>(a: &'a Iter1, b: &'b Iter2) -> f64
where
    &'a Iter1: IntoIterator<Item = Elem1>,
    &'b Iter2: IntoIterator<Item = Elem2>,
    Elem1: PartialEq<Elem2>,
{
    let sim = generic_jaro(a, b);

    if sim > 0.7 {
        let prefix_length = a
            .into_iter()
            .take(4)
            .zip(b)
            .take_while(|(a_elem, b_elem)| a_elem == b_elem)
            .count();

        sim + 0.1 * prefix_length as f64 * (1.0 - sim)
    } else {
        sim
    }
}

/// Like Jaro but gives a boost to strings that have a common prefix.
///
/// ```
/// use strsim::jaro_winkler;
///
/// assert!((0.866 - jaro_winkler("cheeseburger", "cheese fries")).abs() <
///         0.001);
/// ```
pub fn jaro_winkler(a: &str, b: &str) -> f64 {
    generic_jaro_winkler(&StringWrapper(a), &StringWrapper(b))
}

/// Calculates the minimum number of insertions, deletions, and substitutions
/// required to change one sequence into the other.
///
/// ```
/// use strsim::generic_levenshtein;
///
/// assert_eq!(3, generic_levenshtein(&[1,2,3], &[1,2,3,4,5,6]));
/// ```
pub fn generic_levenshtein<'a, 'b, Iter1, Iter2, Elem1, Elem2>(a: &'a Iter1, b: &'b Iter2) -> usize
where
    &'a Iter1: IntoIterator<Item = Elem1>,
    &'b Iter2: IntoIterator<Item = Elem2>,
    Elem1: PartialEq<Elem2>,
{
    let b_len = b.into_iter().count();

    let mut cache: Vec<usize> = (1..b_len + 1).collect();

    let mut result = b_len;

    for (i, a_elem) in a.into_iter().enumerate() {
        result = i + 1;
        let mut distance_b = i;

        for (j, b_elem) in b.into_iter().enumerate() {
            let cost = usize::from(a_elem != b_elem);
            let distance_a = distance_b + cost;
            distance_b = cache[j];
            result = min(result + 1, min(distance_a, distance_b + 1));
            cache[j] = result;
        }
    }

    result
}

/// Calculates the minimum number of insertions, deletions, and substitutions
/// required to change one string into the other.
///
/// ```
/// use strsim::levenshtein;
///
/// assert_eq!(3, levenshtein("kitten", "sitting"));
/// ```
pub fn levenshtein(a: &str, b: &str) -> usize {
    generic_levenshtein(&StringWrapper(a), &StringWrapper(b))
}

/// Calculates a normalized score of the Levenshtein algorithm between 0.0 and
/// 1.0 (inclusive), where 1.0 means the strings are the same.
///
/// ```
/// use strsim::normalized_levenshtein;
///
/// assert!((normalized_levenshtein("kitten", "sitting") - 0.57142).abs() < 0.00001);
/// assert!((normalized_levenshtein("", "") - 1.0).abs() < 0.00001);
/// assert!(normalized_levenshtein("", "second").abs() < 0.00001);
/// assert!(normalized_levenshtein("first", "").abs() < 0.00001);
/// assert!((normalized_levenshtein("string", "string") - 1.0).abs() < 0.00001);
/// ```
pub fn normalized_levenshtein(a: &str, b: &str) -> f64 {
    if a.is_empty() && b.is_empty() {
        return 1.0;
    }
    1.0 - (levenshtein(a, b) as f64) / (a.chars().count().max(b.chars().count()) as f64)
}

/// Like Levenshtein but allows for adjacent transpositions. Each substring can
/// only be edited once.
///
/// ```
/// use strsim::osa_distance;
///
/// assert_eq!(3, osa_distance("ab", "bca"));
/// ```
pub fn osa_distance(a: &str, b: &str) -> usize {
    let b_len = b.chars().count();
    // 0..=b_len behaves like 0..b_len.saturating_add(1) which could be a different size
    // this leads to significantly worse code gen when swapping the vectors below
    let mut prev_two_distances: Vec<usize> = (0..b_len + 1).collect();
    let mut prev_distances: Vec<usize> = (0..b_len + 1).collect();
    let mut curr_distances: Vec<usize> = vec![0; b_len + 1];

    let mut prev_a_char = char::MAX;
    let mut prev_b_char = char::MAX;

    for (i, a_char) in a.chars().enumerate() {
        curr_distances[0] = i + 1;

        for (j, b_char) in b.chars().enumerate() {
            let cost = usize::from(a_char != b_char);
            curr_distances[j + 1] = min(
                curr_distances[j] + 1,
                min(prev_distances[j + 1] + 1, prev_distances[j] + cost),
            );
            if i > 0 && j > 0 && a_char != b_char && a_char == prev_b_char && b_char == prev_a_char
            {
                curr_distances[j + 1] = min(curr_distances[j + 1], prev_two_distances[j - 1] + 1);
            }

            prev_b_char = b_char;
        }

        mem::swap(&mut prev_two_distances, &mut prev_distances);
        mem::swap(&mut prev_distances, &mut curr_distances);
        prev_a_char = a_char;
    }

    // access prev_distances instead of curr_distances since we swapped
    // them above. In case a is empty this would still contain the correct value
    // from initializing the last element to b_len
    prev_distances[b_len]
}

/* Returns the final index for a value in a single vector that represents a fixed
2d grid */
fn flat_index(i: usize, j: usize, width: usize) -> usize {
    j * width + i
}

/// Like optimal string alignment, but substrings can be edited an unlimited
/// number of times, and the triangle inequality holds.
///
/// ```
/// use strsim::generic_damerau_levenshtein;
///
/// assert_eq!(2, generic_damerau_levenshtein(&[1,2], &[2,3,1]));
/// ```
pub fn generic_damerau_levenshtein<Elem>(a_elems: &[Elem], b_elems: &[Elem]) -> usize
where
    Elem: Eq + Hash + Clone,
{
    let a_len = a_elems.len();
    let b_len = b_elems.len();

    if a_len == 0 {
        return b_len;
    }
    if b_len == 0 {
        return a_len;
    }

    let width = a_len + 2;
    let mut distances = vec![0; (a_len + 2) * (b_len + 2)];
    let max_distance = a_len + b_len;
    distances[0] = max_distance;

    for i in 0..(a_len + 1) {
        distances[flat_index(i + 1, 0, width)] = max_distance;
        distances[flat_index(i + 1, 1, width)] = i;
    }

    for j in 0..(b_len + 1) {
        distances[flat_index(0, j + 1, width)] = max_distance;
        distances[flat_index(1, j + 1, width)] = j;
    }

    let mut elems: HashMap<Elem, usize> = HashMap::with_capacity(64);

    for i in 1..(a_len + 1) {
        let mut db = 0;

        for j in 1..(b_len + 1) {
            let k = match elems.get(&b_elems[j - 1]) {
                Some(&value) => value,
                None => 0,
            };

            let insertion_cost = distances[flat_index(i, j + 1, width)] + 1;
            let deletion_cost = distances[flat_index(i + 1, j, width)] + 1;
            let transposition_cost =
                distances[flat_index(k, db, width)] + (i - k - 1) + 1 + (j - db - 1);

            let mut substitution_cost = distances[flat_index(i, j, width)] + 1;
            if a_elems[i - 1] == b_elems[j - 1] {
                db = j;
                substitution_cost -= 1;
            }

            distances[flat_index(i + 1, j + 1, width)] = min(
                substitution_cost,
                min(insertion_cost, min(deletion_cost, transposition_cost)),
            );
        }

        elems.insert(a_elems[i - 1].clone(), i);
    }

    distances[flat_index(a_len + 1, b_len + 1, width)]
}

#[derive(Clone, Copy, PartialEq, Eq)]
struct RowId {
    val: isize,
}

impl Default for RowId {
    fn default() -> Self {
        Self { val: -1 }
    }
}

#[derive(Default, Clone)]
struct GrowingHashmapMapElemChar<ValueType> {
    key: u32,
    value: ValueType,
}

/// specialized hashmap to store user provided types
/// this implementation relies on a couple of base assumptions in order to simplify the implementation
/// - the hashmap does not have an upper limit of included items
/// - the default value for the `ValueType` can be used as a dummy value to indicate an empty cell
/// - elements can't be removed
/// - only allocates memory on first write access.
///   This improves performance for hashmaps that are never written to
struct GrowingHashmapChar<ValueType> {
    used: i32,
    fill: i32,
    mask: i32,
    map: Option<Vec<GrowingHashmapMapElemChar<ValueType>>>,
}

impl<ValueType> Default for GrowingHashmapChar<ValueType>
where
    ValueType: Default + Clone + Eq,
{
    fn default() -> Self {
        Self {
            used: 0,
            fill: 0,
            mask: -1,
            map: None,
        }
    }
}

impl<ValueType> GrowingHashmapChar<ValueType>
where
    ValueType: Default + Clone + Eq + Copy,
{
    fn get(&self, key: u32) -> ValueType {
        self.map
            .as_ref()
            .map_or_else(|| Default::default(), |map| map[self.lookup(key)].value)
    }

    fn get_mut(&mut self, key: u32) -> &mut ValueType {
        if self.map.is_none() {
            self.allocate();
        }

        let mut i = self.lookup(key);
        if self
            .map
            .as_ref()
            .expect("map should have been created above")[i]
            .value
            == Default::default()
        {
            self.fill += 1;
            // resize when 2/3 full
            if self.fill * 3 >= (self.mask + 1) * 2 {
                self.grow((self.used + 1) * 2);
                i = self.lookup(key);
            }

            self.used += 1;
        }

        let elem = &mut self
            .map
            .as_mut()
            .expect("map should have been created above")[i];
        elem.key = key;
        &mut elem.value
    }

    fn allocate(&mut self) {
        self.mask = 8 - 1;
        self.map = Some(vec![GrowingHashmapMapElemChar::default(); 8]);
    }

    /// lookup key inside the hashmap using a similar collision resolution
    /// strategy to `CPython` and `Ruby`
    fn lookup(&self, key: u32) -> usize {
        let hash = key;
        let mut i = hash as usize & self.mask as usize;

        let map = self
            .map
            .as_ref()
            .expect("callers have to ensure map is allocated");

        if map[i].value == Default::default() || map[i].key == key {
            return i;
        }

        let mut perturb = key;
        loop {
            i = (i * 5 + perturb as usize + 1) & self.mask as usize;

            if map[i].value == Default::default() || map[i].key == key {
                return i;
            }

            perturb >>= 5;
        }
    }

    fn grow(&mut self, min_used: i32) {
        let mut new_size = self.mask + 1;
        while new_size <= min_used {
            new_size <<= 1;
        }

        self.fill = self.used;
        self.mask = new_size - 1;

        let old_map = std::mem::replace(
            self.map
                .as_mut()
                .expect("callers have to ensure map is allocated"),
            vec![GrowingHashmapMapElemChar::<ValueType>::default(); new_size as usize],
        );

        for elem in old_map {
            if elem.value != Default::default() {
                let j = self.lookup(elem.key);
                let new_elem = &mut self.map.as_mut().expect("map created above")[j];
                new_elem.key = elem.key;
                new_elem.value = elem.value;
                self.used -= 1;
                if self.used == 0 {
                    break;
                }
            }
        }

        self.used = self.fill;
    }
}

struct HybridGrowingHashmapChar<ValueType> {
    map: GrowingHashmapChar<ValueType>,
    extended_ascii: [ValueType; 256],
}

impl<ValueType> HybridGrowingHashmapChar<ValueType>
where
    ValueType: Default + Clone + Copy + Eq,
{
    fn get(&self, key: char) -> ValueType {
        let value = key as u32;
        if value <= 255 {
            let val_u8 = u8::try_from(value).expect("we check the bounds above");
            self.extended_ascii[usize::from(val_u8)]
        } else {
            self.map.get(value)
        }
    }

    fn get_mut(&mut self, key: char) -> &mut ValueType {
        let value = key as u32;
        if value <= 255 {
            let val_u8 = u8::try_from(value).expect("we check the bounds above");
            &mut self.extended_ascii[usize::from(val_u8)]
        } else {
            self.map.get_mut(value)
        }
    }
}

impl<ValueType> Default for HybridGrowingHashmapChar<ValueType>
where
    ValueType: Default + Clone + Copy + Eq,
{
    fn default() -> Self {
        HybridGrowingHashmapChar {
            map: GrowingHashmapChar::default(),
            extended_ascii: [Default::default(); 256],
        }
    }
}

fn damerau_levenshtein_impl<Iter1, Iter2>(s1: Iter1, len1: usize, s2: Iter2, len2: usize) -> usize
where
    Iter1: Iterator<Item = char> + Clone,
    Iter2: Iterator<Item = char> + Clone,
{
    // The implementations is based on the paper
    // `Linear space string correction algorithm using the Damerau-Levenshtein distance`
    // from Chunchun Zhao and Sartaj Sahni
    //
    // It has a runtime complexity of `O(N*M)` and a memory usage of `O(N+M)`.
    let max_val = max(len1, len2) as isize + 1;

    let mut last_row_id = HybridGrowingHashmapChar::<RowId>::default();

    let size = len2 + 2;
    let mut fr = vec![max_val; size];
    let mut r1 = vec![max_val; size];
    let mut r: Vec<isize> = (max_val..max_val + 1)
        .chain(0..(size - 1) as isize)
        .collect();

    for (i, ch1) in s1.enumerate().map(|(i, ch1)| (i + 1, ch1)) {
        mem::swap(&mut r, &mut r1);
        let mut last_col_id: isize = -1;
        let mut last_i2l1 = r[1];
        r[1] = i as isize;
        let mut t = max_val;

        for (j, ch2) in s2.clone().enumerate().map(|(j, ch2)| (j + 1, ch2)) {
            let diag = r1[j] + isize::from(ch1 != ch2);
            let left = r[j] + 1;
            let up = r1[j + 1] + 1;
            let mut temp = min(diag, min(left, up));

            if ch1 == ch2 {
                last_col_id = j as isize; // last occurence of s1_i
                fr[j + 1] = r1[j - 1]; // save H_k-1,j-2
                t = last_i2l1; // save H_i-2,l-1
            } else {
                let k = last_row_id.get(ch2).val;
                let l = last_col_id;

                if j as isize - l == 1 {
                    let transpose = fr[j + 1] + (i as isize - k);
                    temp = min(temp, transpose);
                } else if i as isize - k == 1 {
                    let transpose = t + (j as isize - l);
                    temp = min(temp, transpose);
                }
            }

            last_i2l1 = r[j + 1];
            r[j + 1] = temp;
        }
        last_row_id.get_mut(ch1).val = i as isize;
    }

    r[len2 + 1] as usize
}

/// Like optimal string alignment, but substrings can be edited an unlimited
/// number of times, and the triangle inequality holds.
///
/// ```
/// use strsim::damerau_levenshtein;
///
/// assert_eq!(2, damerau_levenshtein("ab", "bca"));
/// ```
pub fn damerau_levenshtein(a: &str, b: &str) -> usize {
    damerau_levenshtein_impl(a.chars(), a.chars().count(), b.chars(), b.chars().count())
}

/// Calculates a normalized score of the Damerau–Levenshtein algorithm between
/// 0.0 and 1.0 (inclusive), where 1.0 means the strings are the same.
///
/// ```
/// use strsim::normalized_damerau_levenshtein;
///
/// assert!((normalized_damerau_levenshtein("levenshtein", "löwenbräu") - 0.27272).abs() < 0.00001);
/// assert!((normalized_damerau_levenshtein("", "") - 1.0).abs() < 0.00001);
/// assert!(normalized_damerau_levenshtein("", "flower").abs() < 0.00001);
/// assert!(normalized_damerau_levenshtein("tree", "").abs() < 0.00001);
/// assert!((normalized_damerau_levenshtein("sunglasses", "sunglasses") - 1.0).abs() < 0.00001);
/// ```
pub fn normalized_damerau_levenshtein(a: &str, b: &str) -> f64 {
    if a.is_empty() && b.is_empty() {
        return 1.0;
    }

    let len1 = a.chars().count();
    let len2 = b.chars().count();
    let dist = damerau_levenshtein_impl(a.chars(), len1, b.chars(), len2);
    1.0 - (dist as f64) / (max(len1, len2) as f64)
}

/// Returns an Iterator of char tuples.
fn bigrams(s: &str) -> impl Iterator<Item = (char, char)> + '_ {
    s.chars().zip(s.chars().skip(1))
}

/// Calculates a Sørensen-Dice similarity distance using bigrams.
/// See <https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient>.
///
/// ```
/// use strsim::sorensen_dice;
///
/// assert_eq!(1.0, sorensen_dice("", ""));
/// assert_eq!(0.0, sorensen_dice("", "a"));
/// assert_eq!(0.0, sorensen_dice("french", "quebec"));
/// assert_eq!(1.0, sorensen_dice("ferris", "ferris"));
/// assert_eq!(0.8888888888888888, sorensen_dice("feris", "ferris"));
/// ```
pub fn sorensen_dice(a: &str, b: &str) -> f64 {
    // implementation guided by
    // https://github.com/aceakash/string-similarity/blob/f83ba3cd7bae874c20c429774e911ae8cff8bced/src/index.js#L6

    let a: String = a.chars().filter(|&x| !char::is_whitespace(x)).collect();
    let b: String = b.chars().filter(|&x| !char::is_whitespace(x)).collect();

    if a == b {
        return 1.0;
    }

    if a.len() < 2 || b.len() < 2 {
        return 0.0;
    }

    let mut a_bigrams: HashMap<(char, char), usize> = HashMap::new();

    for bigram in bigrams(&a) {
        *a_bigrams.entry(bigram).or_insert(0) += 1;
    }

    let mut intersection_size = 0_usize;

    for bigram in bigrams(&b) {
        a_bigrams.entry(bigram).and_modify(|bi| {
            if *bi > 0 {
                *bi -= 1;
                intersection_size += 1;
            }
        });
    }

    (2 * intersection_size) as f64 / (a.len() + b.len() - 2) as f64
}

#[cfg(test)]
mod tests {
    use super::*;

    macro_rules! assert_delta {
        ($x:expr, $y:expr) => {
            assert_delta!($x, $y, 1e-5);
        };
        ($x:expr, $y:expr, $d:expr) => {
            if ($x - $y).abs() > $d {
                panic!(
                    "assertion failed: actual: `{}`, expected: `{}`: \
                    actual not within < {} of expected",
                    $x, $y, $d
                );
            }
        };
    }

    #[test]
    fn bigrams_iterator() {
        let mut bi = bigrams("abcde");

        assert_eq!(Some(('a', 'b')), bi.next());
        assert_eq!(Some(('b', 'c')), bi.next());
        assert_eq!(Some(('c', 'd')), bi.next());
        assert_eq!(Some(('d', 'e')), bi.next());
        assert_eq!(None, bi.next());
    }

    fn assert_hamming_dist(dist: usize, str1: &str, str2: &str) {
        assert_eq!(Ok(dist), hamming(str1, str2));
    }

    #[test]
    fn hamming_empty() {
        assert_hamming_dist(0, "", "")
    }

    #[test]
    fn hamming_same() {
        assert_hamming_dist(0, "hamming", "hamming")
    }

    #[test]
    fn hamming_numbers() {
        assert_eq!(Ok(1), generic_hamming(&[1, 2, 4], &[1, 2, 3]));
    }

    #[test]
    fn hamming_diff() {
        assert_hamming_dist(3, "hamming", "hammers")
    }

    #[test]
    fn hamming_diff_multibyte() {
        assert_hamming_dist(2, "hamming", "h香mmüng");
    }

    #[test]
    fn hamming_unequal_length() {
        assert_eq!(
            Err(StrSimError::DifferentLengthArgs),
            generic_hamming("ham".chars(), "hamming".chars())
        );
    }

    #[test]
    fn hamming_names() {
        assert_hamming_dist(14, "Friedrich Nietzs", "Jean-Paul Sartre")
    }

    #[test]
    fn jaro_both_empty() {
        assert_eq!(1.0, jaro("", ""));
    }

    #[test]
    fn jaro_first_empty() {
        assert_eq!(0.0, jaro("", "jaro"));
    }

    #[test]
    fn jaro_second_empty() {
        assert_eq!(0.0, jaro("distance", ""));
    }

    #[test]
    fn jaro_same() {
        assert_eq!(1.0, jaro("jaro", "jaro"));
    }

    #[test]
    fn jaro_multibyte() {
        assert_delta!(0.818, jaro("testabctest", "testöঙ香test"), 0.001);
        assert_delta!(0.818, jaro("testöঙ香test", "testabctest"), 0.001);
    }

    #[test]
    fn jaro_diff_short() {
        assert_delta!(0.767, jaro("dixon", "dicksonx"), 0.001);
    }

    #[test]
    fn jaro_diff_one_character() {
        assert_eq!(0.0, jaro("a", "b"));
    }

    #[test]
    fn jaro_same_one_character() {
        assert_eq!(1.0, jaro("a", "a"));
    }

    #[test]
    fn generic_jaro_diff() {
        assert_eq!(0.0, generic_jaro(&[1, 2], &[3, 4]));
    }

    #[test]
    fn jaro_diff_one_and_two() {
        assert_delta!(0.83, jaro("a", "ab"), 0.01);
    }

    #[test]
    fn jaro_diff_two_and_one() {
        assert_delta!(0.83, jaro("ab", "a"), 0.01);
    }

    #[test]
    fn jaro_diff_no_transposition() {
        assert_delta!(0.822, jaro("dwayne", "duane"), 0.001);
    }

    #[test]
    fn jaro_diff_with_transposition() {
        assert_delta!(0.944, jaro("martha", "marhta"), 0.001);
        assert_delta!(0.6, jaro("a jke", "jane a k"), 0.001);
    }

    #[test]
    fn jaro_names() {
        assert_delta!(
            0.392,
            jaro("Friedrich Nietzsche", "Jean-Paul Sartre"),
            0.001
        );
    }

    #[test]
    fn jaro_winkler_both_empty() {
        assert_eq!(1.0, jaro_winkler("", ""));
    }

    #[test]
    fn jaro_winkler_first_empty() {
        assert_eq!(0.0, jaro_winkler("", "jaro-winkler"));
    }

    #[test]
    fn jaro_winkler_second_empty() {
        assert_eq!(0.0, jaro_winkler("distance", ""));
    }

    #[test]
    fn jaro_winkler_same() {
        assert_eq!(1.0, jaro_winkler("Jaro-Winkler", "Jaro-Winkler"));
    }

    #[test]
    fn jaro_winkler_multibyte() {
        assert_delta!(0.89, jaro_winkler("testabctest", "testöঙ香test"), 0.001);
        assert_delta!(0.89, jaro_winkler("testöঙ香test", "testabctest"), 0.001);
    }

    #[test]
    fn jaro_winkler_diff_short() {
        assert_delta!(0.813, jaro_winkler("dixon", "dicksonx"), 0.001);
        assert_delta!(0.813, jaro_winkler("dicksonx", "dixon"), 0.001);
    }

    #[test]
    fn jaro_winkler_diff_one_character() {
        assert_eq!(0.0, jaro_winkler("a", "b"));
    }

    #[test]
    fn jaro_winkler_same_one_character() {
        assert_eq!(1.0, jaro_winkler("a", "a"));
    }

    #[test]
    fn jaro_winkler_diff_no_transposition() {
        assert_delta!(0.84, jaro_winkler("dwayne", "duane"), 0.001);
    }

    #[test]
    fn jaro_winkler_diff_with_transposition() {
        assert_delta!(0.961, jaro_winkler("martha", "marhta"), 0.001);
        assert_delta!(0.6, jaro_winkler("a jke", "jane a k"), 0.001);
    }

    #[test]
    fn jaro_winkler_names() {
        assert_delta!(
            0.452,
            jaro_winkler("Friedrich Nietzsche", "Fran-Paul Sartre"),
            0.001
        );
    }

    #[test]
    fn jaro_winkler_long_prefix() {
        assert_delta!(0.866, jaro_winkler("cheeseburger", "cheese fries"), 0.001);
    }

    #[test]
    fn jaro_winkler_more_names() {
        assert_delta!(0.868, jaro_winkler("Thorkel", "Thorgier"), 0.001);
    }

    #[test]
    fn jaro_winkler_length_of_one() {
        assert_delta!(0.738, jaro_winkler("Dinsdale", "D"), 0.001);
    }

    #[test]
    fn jaro_winkler_very_long_prefix() {
        assert_delta!(
            0.98519,
            jaro_winkler("thequickbrownfoxjumpedoverx", "thequickbrownfoxjumpedovery")
        );
    }

    #[test]
    fn levenshtein_empty() {
        assert_eq!(0, levenshtein("", ""));
    }

    #[test]
    fn levenshtein_same() {
        assert_eq!(0, levenshtein("levenshtein", "levenshtein"));
    }

    #[test]
    fn levenshtein_diff_short() {
        assert_eq!(3, levenshtein("kitten", "sitting"));
    }

    #[test]
    fn levenshtein_diff_with_space() {
        assert_eq!(5, levenshtein("hello, world", "bye, world"));
    }

    #[test]
    fn levenshtein_diff_multibyte() {
        assert_eq!(3, levenshtein("öঙ香", "abc"));
        assert_eq!(3, levenshtein("abc", "öঙ香"));
    }

    #[test]
    fn levenshtein_diff_longer() {
        let a = "The quick brown fox jumped over the angry dog.";
        let b = "Lorem ipsum dolor sit amet, dicta latine an eam.";
        assert_eq!(37, levenshtein(a, b));
    }

    #[test]
    fn levenshtein_first_empty() {
        assert_eq!(7, levenshtein("", "sitting"));
    }

    #[test]
    fn levenshtein_second_empty() {
        assert_eq!(6, levenshtein("kitten", ""));
    }

    #[test]
    fn normalized_levenshtein_diff_short() {
        assert_delta!(0.57142, normalized_levenshtein("kitten", "sitting"));
    }

    #[test]
    fn normalized_levenshtein_for_empty_strings() {
        assert_delta!(1.0, normalized_levenshtein("", ""));
    }

    #[test]
    fn normalized_levenshtein_first_empty() {
        assert_delta!(0.0, normalized_levenshtein("", "second"));
    }

    #[test]
    fn normalized_levenshtein_second_empty() {
        assert_delta!(0.0, normalized_levenshtein("first", ""));
    }

    #[test]
    fn normalized_levenshtein_identical_strings() {
        assert_delta!(1.0, normalized_levenshtein("identical", "identical"));
    }

    #[test]
    fn osa_distance_empty() {
        assert_eq!(0, osa_distance("", ""));
    }

    #[test]
    fn osa_distance_same() {
        assert_eq!(0, osa_distance("damerau", "damerau"));
    }

    #[test]
    fn osa_distance_first_empty() {
        assert_eq!(7, osa_distance("", "damerau"));
    }

    #[test]
    fn osa_distance_second_empty() {
        assert_eq!(7, osa_distance("damerau", ""));
    }

    #[test]
    fn osa_distance_diff() {
        assert_eq!(3, osa_distance("ca", "abc"));
    }

    #[test]
    fn osa_distance_diff_short() {
        assert_eq!(3, osa_distance("damerau", "aderua"));
    }

    #[test]
    fn osa_distance_diff_reversed() {
        assert_eq!(3, osa_distance("aderua", "damerau"));
    }

    #[test]
    fn osa_distance_diff_multibyte() {
        assert_eq!(3, osa_distance("öঙ香", "abc"));
        assert_eq!(3, osa_distance("abc", "öঙ香"));
    }

    #[test]
    fn osa_distance_diff_unequal_length() {
        assert_eq!(6, osa_distance("damerau", "aderuaxyz"));
    }

    #[test]
    fn osa_distance_diff_unequal_length_reversed() {
        assert_eq!(6, osa_distance("aderuaxyz", "damerau"));
    }

    #[test]
    fn osa_distance_diff_comedians() {
        assert_eq!(5, osa_distance("Stewart", "Colbert"));
    }

    #[test]
    fn osa_distance_many_transpositions() {
        assert_eq!(4, osa_distance("abcdefghijkl", "bacedfgihjlk"));
    }

    #[test]
    fn osa_distance_diff_longer() {
        let a = "The quick brown fox jumped over the angry dog.";
        let b = "Lehem ipsum dolor sit amet, dicta latine an eam.";
        assert_eq!(36, osa_distance(a, b));
    }

    #[test]
    fn osa_distance_beginning_transposition() {
        assert_eq!(1, osa_distance("foobar", "ofobar"));
    }

    #[test]
    fn osa_distance_end_transposition() {
        assert_eq!(1, osa_distance("specter", "spectre"));
    }

    #[test]
    fn osa_distance_restricted_edit() {
        assert_eq!(4, osa_distance("a cat", "an abct"));
    }

    #[test]
    fn damerau_levenshtein_empty() {
        assert_eq!(0, damerau_levenshtein("", ""));
    }

    #[test]
    fn damerau_levenshtein_same() {
        assert_eq!(0, damerau_levenshtein("damerau", "damerau"));
    }

    #[test]
    fn damerau_levenshtein_first_empty() {
        assert_eq!(7, damerau_levenshtein("", "damerau"));
    }

    #[test]
    fn damerau_levenshtein_second_empty() {
        assert_eq!(7, damerau_levenshtein("damerau", ""));
    }

    #[test]
    fn damerau_levenshtein_diff() {
        assert_eq!(2, damerau_levenshtein("ca", "abc"));
    }

    #[test]
    fn damerau_levenshtein_diff_short() {
        assert_eq!(3, damerau_levenshtein("damerau", "aderua"));
    }

    #[test]
    fn damerau_levenshtein_diff_reversed() {
        assert_eq!(3, damerau_levenshtein("aderua", "damerau"));
    }

    #[test]
    fn damerau_levenshtein_diff_multibyte() {
        assert_eq!(3, damerau_levenshtein("öঙ香", "abc"));
        assert_eq!(3, damerau_levenshtein("abc", "öঙ香"));
    }

    #[test]
    fn damerau_levenshtein_diff_unequal_length() {
        assert_eq!(6, damerau_levenshtein("damerau", "aderuaxyz"));
    }

    #[test]
    fn damerau_levenshtein_diff_unequal_length_reversed() {
        assert_eq!(6, damerau_levenshtein("aderuaxyz", "damerau"));
    }

    #[test]
    fn damerau_levenshtein_diff_comedians() {
        assert_eq!(5, damerau_levenshtein("Stewart", "Colbert"));
    }

    #[test]
    fn damerau_levenshtein_many_transpositions() {
        assert_eq!(4, damerau_levenshtein("abcdefghijkl", "bacedfgihjlk"));
    }

    #[test]
    fn damerau_levenshtein_diff_longer() {
        let a = "The quick brown fox jumped over the angry dog.";
        let b = "Lehem ipsum dolor sit amet, dicta latine an eam.";
        assert_eq!(36, damerau_levenshtein(a, b));
    }

    #[test]
    fn damerau_levenshtein_beginning_transposition() {
        assert_eq!(1, damerau_levenshtein("foobar", "ofobar"));
    }

    #[test]
    fn damerau_levenshtein_end_transposition() {
        assert_eq!(1, damerau_levenshtein("specter", "spectre"));
    }

    #[test]
    fn damerau_levenshtein_unrestricted_edit() {
        assert_eq!(3, damerau_levenshtein("a cat", "an abct"));
    }

    #[test]
    fn normalized_damerau_levenshtein_diff_short() {
        assert_delta!(
            0.27272,
            normalized_damerau_levenshtein("levenshtein", "löwenbräu")
        );
    }

    #[test]
    fn normalized_damerau_levenshtein_for_empty_strings() {
        assert_delta!(1.0, normalized_damerau_levenshtein("", ""));
    }

    #[test]
    fn normalized_damerau_levenshtein_first_empty() {
        assert_delta!(0.0, normalized_damerau_levenshtein("", "flower"));
    }

    #[test]
    fn normalized_damerau_levenshtein_second_empty() {
        assert_delta!(0.0, normalized_damerau_levenshtein("tree", ""));
    }

    #[test]
    fn normalized_damerau_levenshtein_identical_strings() {
        assert_delta!(
            1.0,
            normalized_damerau_levenshtein("sunglasses", "sunglasses")
        );
    }

    #[test]
    fn sorensen_dice_all() {
        // test cases taken from
        // https://github.com/aceakash/string-similarity/blob/f83ba3cd7bae874c20c429774e911ae8cff8bced/src/spec/index.spec.js#L11

        assert_delta!(1.0, sorensen_dice("a", "a"));
        assert_delta!(0.0, sorensen_dice("a", "b"));
        assert_delta!(1.0, sorensen_dice("", ""));
        assert_delta!(0.0, sorensen_dice("a", ""));
        assert_delta!(0.0, sorensen_dice("", "a"));
        assert_delta!(1.0, sorensen_dice("apple event", "apple    event"));
        assert_delta!(0.90909, sorensen_dice("iphone", "iphone x"));
        assert_delta!(0.0, sorensen_dice("french", "quebec"));
        assert_delta!(1.0, sorensen_dice("france", "france"));
        assert_delta!(0.2, sorensen_dice("fRaNce", "france"));
        assert_delta!(0.8, sorensen_dice("healed", "sealed"));
        assert_delta!(
            0.78788,
            sorensen_dice("web applications", "applications of the web")
        );
        assert_delta!(
            0.92,
            sorensen_dice(
                "this will have a typo somewhere",
                "this will huve a typo somewhere"
            )
        );
        assert_delta!(
            0.60606,
            sorensen_dice(
                "Olive-green table for sale, in extremely good condition.",
                "For sale: table in very good  condition, olive green in colour."
            )
        );
        assert_delta!(
            0.25581,
            sorensen_dice(
                "Olive-green table for sale, in extremely good condition.",
                "For sale: green Subaru Impreza, 210,000 miles"
            )
        );
        assert_delta!(
            0.14118,
            sorensen_dice(
                "Olive-green table for sale, in extremely good condition.",
                "Wanted: mountain bike with at least 21 gears."
            )
        );
        assert_delta!(
            0.77419,
            sorensen_dice("this has one extra word", "this has one word")
        );
    }
}


================================================
FILE: tests/lib.rs
================================================
extern crate strsim;

use strsim::{
    damerau_levenshtein, hamming, jaro, jaro_winkler, levenshtein, normalized_damerau_levenshtein,
    normalized_levenshtein, osa_distance,
};

macro_rules! assert_delta {
    ($x:expr, $y:expr) => {
        assert_delta!($x, $y, 1e-5);
    };
    ($x:expr, $y:expr, $d:expr) => {
        if ($x - $y).abs() > $d {
            panic!(
                "assertion failed: actual: `{}`, expected: `{}`: \
                actual not within < {} of expected",
                $x, $y, $d
            );
        }
    };
}

#[test]
fn hamming_works() {
    match hamming("hamming", "hammers") {
        Ok(distance) => assert_eq!(3, distance),
        Err(why) => panic!("{:?}", why),
    }
}

#[test]
fn levenshtein_works() {
    assert_eq!(3, levenshtein("kitten", "sitting"));
}

#[test]
fn normalized_levenshtein_works() {
    assert_delta!(0.57142, normalized_levenshtein("kitten", "sitting"));
}

#[test]
fn osa_distance_works() {
    assert_eq!(3, osa_distance("ac", "cba"));
}

#[test]
fn damerau_levenshtein_works() {
    assert_eq!(2, damerau_levenshtein("ac", "cba"));
}

#[test]
fn normalized_damerau_levenshtein_works() {
    assert_delta!(
        0.27272,
        normalized_damerau_levenshtein("levenshtein", "löwenbräu")
    );
}

#[test]
fn jaro_works() {
    assert_delta!(
        0.392,
        jaro("Friedrich Nietzsche", "Jean-Paul Sartre"),
        0.001
    );
}

#[test]
fn jaro_winkler_works() {
    assert_delta!(0.866, jaro_winkler("cheeseburger", "cheese fries"), 0.001);
}
Download .txt
gitextract_h7ck84ay/

├── .editorconfig
├── .gitattributes
├── .github/
│   ├── FUNDING.yml
│   └── workflows/
│       └── ci.yml
├── .gitignore
├── CHANGELOG.md
├── Cargo.toml
├── LICENSE
├── README.md
├── SECURITY.md
├── benches/
│   └── benches.rs
├── dev
├── src/
│   └── lib.rs
└── tests/
    └── lib.rs
Download .txt
SYMBOL INDEX (145 symbols across 3 files)

FILE: benches/benches.rs
  function bench_hamming (line 10) | fn bench_hamming(bencher: &mut Bencher) {
  function bench_jaro (line 19) | fn bench_jaro(bencher: &mut Bencher) {
  function bench_jaro_winkler (line 28) | fn bench_jaro_winkler(bencher: &mut Bencher) {
  function bench_levenshtein (line 37) | fn bench_levenshtein(bencher: &mut Bencher) {
  function bench_levenshtein_on_u8 (line 46) | fn bench_levenshtein_on_u8(bencher: &mut Bencher) {
  function bench_normalized_levenshtein (line 53) | fn bench_normalized_levenshtein(bencher: &mut Bencher) {
  function bench_osa_distance (line 62) | fn bench_osa_distance(bencher: &mut Bencher) {
  function bench_damerau_levenshtein (line 71) | fn bench_damerau_levenshtein(bencher: &mut Bencher) {
  function bench_normalized_damerau_levenshtein (line 80) | fn bench_normalized_damerau_levenshtein(bencher: &mut Bencher) {
  function bench_sorensen_dice (line 89) | fn bench_sorensen_dice(bencher: &mut Bencher) {

FILE: src/lib.rs
  type StrSimError (line 33) | pub enum StrSimError {
  method fmt (line 38) | fn fmt(&self, fmt: &mut Formatter<'_>) -> Result<(), fmt::Error> {
  type HammingResult (line 49) | pub type HammingResult = Result<usize, StrSimError>;
  function generic_hamming (line 53) | pub fn generic_hamming<Iter1, Iter2, Elem1, Elem2>(a: Iter1, b: Iter2) -...
  function hamming (line 84) | pub fn hamming(a: &str, b: &str) -> HammingResult {
  function generic_jaro (line 90) | pub fn generic_jaro<'a, 'b, Iter1, Iter2, Elem1, Elem2>(a: &'a Iter1, b:...
  type StringWrapper (line 162) | struct StringWrapper<'a>(&'a str);
  type Item (line 165) | type Item = char;
  type IntoIter (line 166) | type IntoIter = Chars<'b>;
  method into_iter (line 168) | fn into_iter(self) -> Self::IntoIter {
  function jaro (line 182) | pub fn jaro(a: &str, b: &str) -> f64 {
  function generic_jaro_winkler (line 187) | pub fn generic_jaro_winkler<'a, 'b, Iter1, Iter2, Elem1, Elem2>(a: &'a I...
  function jaro_winkler (line 217) | pub fn jaro_winkler(a: &str, b: &str) -> f64 {
  function generic_levenshtein (line 229) | pub fn generic_levenshtein<'a, 'b, Iter1, Iter2, Elem1, Elem2>(a: &'a It...
  function levenshtein (line 265) | pub fn levenshtein(a: &str, b: &str) -> usize {
  function normalized_levenshtein (line 281) | pub fn normalized_levenshtein(a: &str, b: &str) -> f64 {
  function osa_distance (line 296) | pub fn osa_distance(a: &str, b: &str) -> usize {
  function flat_index (line 337) | fn flat_index(i: usize, j: usize, width: usize) -> usize {
  function generic_damerau_levenshtein (line 349) | pub fn generic_damerau_levenshtein<Elem>(a_elems: &[Elem], b_elems: &[El...
  type RowId (line 413) | struct RowId {
  method default (line 418) | fn default() -> Self {
  type GrowingHashmapMapElemChar (line 424) | struct GrowingHashmapMapElemChar<ValueType> {
  type GrowingHashmapChar (line 436) | struct GrowingHashmapChar<ValueType> {
  method default (line 447) | fn default() -> Self {
  function get (line 461) | fn get(&self, key: u32) -> ValueType {
  function get_mut (line 467) | fn get_mut(&mut self, key: u32) -> &mut ValueType {
  function allocate (line 498) | fn allocate(&mut self) {
  function lookup (line 505) | fn lookup(&self, key: u32) -> usize {
  function grow (line 530) | fn grow(&mut self, min_used: i32) {
  type HybridGrowingHashmapChar (line 563) | struct HybridGrowingHashmapChar<ValueType> {
  function get (line 572) | fn get(&self, key: char) -> ValueType {
  function get_mut (line 582) | fn get_mut(&mut self, key: char) -> &mut ValueType {
  method default (line 597) | fn default() -> Self {
  function damerau_levenshtein_impl (line 605) | fn damerau_levenshtein_impl<Iter1, Iter2>(s1: Iter1, len1: usize, s2: It...
  function damerau_levenshtein (line 673) | pub fn damerau_levenshtein(a: &str, b: &str) -> usize {
  function normalized_damerau_levenshtein (line 689) | pub fn normalized_damerau_levenshtein(a: &str, b: &str) -> f64 {
  function bigrams (line 701) | fn bigrams(s: &str) -> impl Iterator<Item = (char, char)> + '_ {
  function sorensen_dice (line 717) | pub fn sorensen_dice(a: &str, b: &str) -> f64 {
  function bigrams_iterator (line 772) | fn bigrams_iterator() {
  function assert_hamming_dist (line 782) | fn assert_hamming_dist(dist: usize, str1: &str, str2: &str) {
  function hamming_empty (line 787) | fn hamming_empty() {
  function hamming_same (line 792) | fn hamming_same() {
  function hamming_numbers (line 797) | fn hamming_numbers() {
  function hamming_diff (line 802) | fn hamming_diff() {
  function hamming_diff_multibyte (line 807) | fn hamming_diff_multibyte() {
  function hamming_unequal_length (line 812) | fn hamming_unequal_length() {
  function hamming_names (line 820) | fn hamming_names() {
  function jaro_both_empty (line 825) | fn jaro_both_empty() {
  function jaro_first_empty (line 830) | fn jaro_first_empty() {
  function jaro_second_empty (line 835) | fn jaro_second_empty() {
  function jaro_same (line 840) | fn jaro_same() {
  function jaro_multibyte (line 845) | fn jaro_multibyte() {
  function jaro_diff_short (line 851) | fn jaro_diff_short() {
  function jaro_diff_one_character (line 856) | fn jaro_diff_one_character() {
  function jaro_same_one_character (line 861) | fn jaro_same_one_character() {
  function generic_jaro_diff (line 866) | fn generic_jaro_diff() {
  function jaro_diff_one_and_two (line 871) | fn jaro_diff_one_and_two() {
  function jaro_diff_two_and_one (line 876) | fn jaro_diff_two_and_one() {
  function jaro_diff_no_transposition (line 881) | fn jaro_diff_no_transposition() {
  function jaro_diff_with_transposition (line 886) | fn jaro_diff_with_transposition() {
  function jaro_names (line 892) | fn jaro_names() {
  function jaro_winkler_both_empty (line 901) | fn jaro_winkler_both_empty() {
  function jaro_winkler_first_empty (line 906) | fn jaro_winkler_first_empty() {
  function jaro_winkler_second_empty (line 911) | fn jaro_winkler_second_empty() {
  function jaro_winkler_same (line 916) | fn jaro_winkler_same() {
  function jaro_winkler_multibyte (line 921) | fn jaro_winkler_multibyte() {
  function jaro_winkler_diff_short (line 927) | fn jaro_winkler_diff_short() {
  function jaro_winkler_diff_one_character (line 933) | fn jaro_winkler_diff_one_character() {
  function jaro_winkler_same_one_character (line 938) | fn jaro_winkler_same_one_character() {
  function jaro_winkler_diff_no_transposition (line 943) | fn jaro_winkler_diff_no_transposition() {
  function jaro_winkler_diff_with_transposition (line 948) | fn jaro_winkler_diff_with_transposition() {
  function jaro_winkler_names (line 954) | fn jaro_winkler_names() {
  function jaro_winkler_long_prefix (line 963) | fn jaro_winkler_long_prefix() {
  function jaro_winkler_more_names (line 968) | fn jaro_winkler_more_names() {
  function jaro_winkler_length_of_one (line 973) | fn jaro_winkler_length_of_one() {
  function jaro_winkler_very_long_prefix (line 978) | fn jaro_winkler_very_long_prefix() {
  function levenshtein_empty (line 986) | fn levenshtein_empty() {
  function levenshtein_same (line 991) | fn levenshtein_same() {
  function levenshtein_diff_short (line 996) | fn levenshtein_diff_short() {
  function levenshtein_diff_with_space (line 1001) | fn levenshtein_diff_with_space() {
  function levenshtein_diff_multibyte (line 1006) | fn levenshtein_diff_multibyte() {
  function levenshtein_diff_longer (line 1012) | fn levenshtein_diff_longer() {
  function levenshtein_first_empty (line 1019) | fn levenshtein_first_empty() {
  function levenshtein_second_empty (line 1024) | fn levenshtein_second_empty() {
  function normalized_levenshtein_diff_short (line 1029) | fn normalized_levenshtein_diff_short() {
  function normalized_levenshtein_for_empty_strings (line 1034) | fn normalized_levenshtein_for_empty_strings() {
  function normalized_levenshtein_first_empty (line 1039) | fn normalized_levenshtein_first_empty() {
  function normalized_levenshtein_second_empty (line 1044) | fn normalized_levenshtein_second_empty() {
  function normalized_levenshtein_identical_strings (line 1049) | fn normalized_levenshtein_identical_strings() {
  function osa_distance_empty (line 1054) | fn osa_distance_empty() {
  function osa_distance_same (line 1059) | fn osa_distance_same() {
  function osa_distance_first_empty (line 1064) | fn osa_distance_first_empty() {
  function osa_distance_second_empty (line 1069) | fn osa_distance_second_empty() {
  function osa_distance_diff (line 1074) | fn osa_distance_diff() {
  function osa_distance_diff_short (line 1079) | fn osa_distance_diff_short() {
  function osa_distance_diff_reversed (line 1084) | fn osa_distance_diff_reversed() {
  function osa_distance_diff_multibyte (line 1089) | fn osa_distance_diff_multibyte() {
  function osa_distance_diff_unequal_length (line 1095) | fn osa_distance_diff_unequal_length() {
  function osa_distance_diff_unequal_length_reversed (line 1100) | fn osa_distance_diff_unequal_length_reversed() {
  function osa_distance_diff_comedians (line 1105) | fn osa_distance_diff_comedians() {
  function osa_distance_many_transpositions (line 1110) | fn osa_distance_many_transpositions() {
  function osa_distance_diff_longer (line 1115) | fn osa_distance_diff_longer() {
  function osa_distance_beginning_transposition (line 1122) | fn osa_distance_beginning_transposition() {
  function osa_distance_end_transposition (line 1127) | fn osa_distance_end_transposition() {
  function osa_distance_restricted_edit (line 1132) | fn osa_distance_restricted_edit() {
  function damerau_levenshtein_empty (line 1137) | fn damerau_levenshtein_empty() {
  function damerau_levenshtein_same (line 1142) | fn damerau_levenshtein_same() {
  function damerau_levenshtein_first_empty (line 1147) | fn damerau_levenshtein_first_empty() {
  function damerau_levenshtein_second_empty (line 1152) | fn damerau_levenshtein_second_empty() {
  function damerau_levenshtein_diff (line 1157) | fn damerau_levenshtein_diff() {
  function damerau_levenshtein_diff_short (line 1162) | fn damerau_levenshtein_diff_short() {
  function damerau_levenshtein_diff_reversed (line 1167) | fn damerau_levenshtein_diff_reversed() {
  function damerau_levenshtein_diff_multibyte (line 1172) | fn damerau_levenshtein_diff_multibyte() {
  function damerau_levenshtein_diff_unequal_length (line 1178) | fn damerau_levenshtein_diff_unequal_length() {
  function damerau_levenshtein_diff_unequal_length_reversed (line 1183) | fn damerau_levenshtein_diff_unequal_length_reversed() {
  function damerau_levenshtein_diff_comedians (line 1188) | fn damerau_levenshtein_diff_comedians() {
  function damerau_levenshtein_many_transpositions (line 1193) | fn damerau_levenshtein_many_transpositions() {
  function damerau_levenshtein_diff_longer (line 1198) | fn damerau_levenshtein_diff_longer() {
  function damerau_levenshtein_beginning_transposition (line 1205) | fn damerau_levenshtein_beginning_transposition() {
  function damerau_levenshtein_end_transposition (line 1210) | fn damerau_levenshtein_end_transposition() {
  function damerau_levenshtein_unrestricted_edit (line 1215) | fn damerau_levenshtein_unrestricted_edit() {
  function normalized_damerau_levenshtein_diff_short (line 1220) | fn normalized_damerau_levenshtein_diff_short() {
  function normalized_damerau_levenshtein_for_empty_strings (line 1228) | fn normalized_damerau_levenshtein_for_empty_strings() {
  function normalized_damerau_levenshtein_first_empty (line 1233) | fn normalized_damerau_levenshtein_first_empty() {
  function normalized_damerau_levenshtein_second_empty (line 1238) | fn normalized_damerau_levenshtein_second_empty() {
  function normalized_damerau_levenshtein_identical_strings (line 1243) | fn normalized_damerau_levenshtein_identical_strings() {
  function sorensen_dice_all (line 1251) | fn sorensen_dice_all() {

FILE: tests/lib.rs
  function hamming_works (line 24) | fn hamming_works() {
  function levenshtein_works (line 32) | fn levenshtein_works() {
  function normalized_levenshtein_works (line 37) | fn normalized_levenshtein_works() {
  function osa_distance_works (line 42) | fn osa_distance_works() {
  function damerau_levenshtein_works (line 47) | fn damerau_levenshtein_works() {
  function normalized_damerau_levenshtein_works (line 52) | fn normalized_damerau_levenshtein_works() {
  function jaro_works (line 60) | fn jaro_works() {
  function jaro_winkler_works (line 69) | fn jaro_winkler_works() {
Condensed preview — 14 files, each showing path, character count, and a content snippet. Download the .json file or copy for the full structured content (59K chars).
[
  {
    "path": ".editorconfig",
    "chars": 213,
    "preview": "# editorconfig.org\nroot = true\n\n[*]\ncharset = utf-8\nend_of_line = lf\nindent_brace_style = K&R\nindent_size = 4\nindent_sty"
  },
  {
    "path": ".gitattributes",
    "chars": 84,
    "preview": "# Override core.autocrlf settings to keep line endings consistent (LF)\n* text=auto\n\n"
  },
  {
    "path": ".github/FUNDING.yml",
    "chars": 223,
    "preview": "github: [dguo, maxbachmann]\nko_fi: dannyguo\nliberapay: dannyguo\ncustom: [\"https://www.paypal.com/donate/?hosted_button_i"
  },
  {
    "path": ".github/workflows/ci.yml",
    "chars": 767,
    "preview": "name: CI\n\non:\n  push:\n    branches:\n      - main\n  pull_request:\n\njobs:\n  build:\n    strategy:\n      matrix:\n        os:"
  },
  {
    "path": ".gitignore",
    "chars": 42,
    "preview": "/target\n/Cargo.lock\n*.swp\n*.swo\n.DS_Store\n"
  },
  {
    "path": "CHANGELOG.md",
    "chars": 6150,
    "preview": "# Change Log\n\nThis project attempts to adhere to [Semantic Versioning](http://semver.org).\n\n## [Unreleased]\n\n## [0.11.1]"
  },
  {
    "path": "Cargo.toml",
    "chars": 648,
    "preview": "[package]\nname = \"strsim\"\nversion = \"0.11.1\"\nauthors = [\"Danny Guo <danny@dannyguo.com>\", \"maxbachmann <oss@maxbachmann."
  },
  {
    "path": "LICENSE",
    "chars": 1166,
    "preview": "The MIT License (MIT)\n\nCopyright (c) 2015 Danny Guo\nCopyright (c) 2016 Titus Wormer <tituswormer@gmail.com>\nCopyright (c"
  },
  {
    "path": "README.md",
    "chars": 3379,
    "preview": "# strsim-rs\n\n[![Crates.io](https://img.shields.io/crates/v/strsim.svg)](https://crates.io/crates/strsim)\n[![Crates.io](h"
  },
  {
    "path": "SECURITY.md",
    "chars": 987,
    "preview": "## Reporting Security Issues\n\nIf you believe you have found a security vulnerability in the project, please report it to"
  },
  {
    "path": "benches/benches.rs",
    "chars": 2299,
    "preview": "//! Benchmarks for strsim.\n\n#![feature(test)]\n\nextern crate strsim;\nextern crate test;\nuse self::test::Bencher;\n\n#[bench"
  },
  {
    "path": "dev",
    "chars": 1126,
    "preview": "#!/usr/bin/env python3\n# ./dev --help\n\nimport argparse\nimport os\nfrom subprocess import run\nimport sys\n\nparser = argpars"
  },
  {
    "path": "src/lib.rs",
    "chars": 37086,
    "preview": "//! This library implements string similarity metrics.\n\n#![forbid(unsafe_code)]\n#![warn(rust_2018_idioms)]\n#![allow(\n   "
  },
  {
    "path": "tests/lib.rs",
    "chars": 1534,
    "preview": "extern crate strsim;\n\nuse strsim::{\n    damerau_levenshtein, hamming, jaro, jaro_winkler, levenshtein, normalized_damera"
  }
]

About this extraction

This page contains the full source code of the dguo/strsim-rs GitHub repository, extracted and formatted as plain text for AI agents and large language models (LLMs). The extraction includes 14 files (54.4 KB), approximately 16.8k tokens, and a symbol index with 145 extracted functions, classes, methods, constants, and types. Use this with OpenClaw, Claude, ChatGPT, Cursor, Windsurf, or any other AI tool that accepts text input. You can copy the full output to your clipboard or download it as a .txt file.

Extracted by GitExtract — free GitHub repo to text converter for AI. Built by Nikandr Surkov.

Copied to clipboard!